EMAGE mouse gene expression spatial database

EMAGE:19365

Sec61g SEC61, gamma subunit ( MGI:1202066)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_002177. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_002177_01	euxassay_002177_02	euxassay_002177_03	euxassay_002177_04

euxassay_002177_05	euxassay_002177_06	euxassay_002177_07	euxassay_002177_08	euxassay_002177_09

euxassay_002177_10	euxassay_002177_11	euxassay_002177_12	euxassay_002177_13	euxassay_002177_14

euxassay_002177_15	euxassay_002177_16	euxassay_002177_17	euxassay_002177_18	euxassay_002177_19

euxassay_002177_20	euxassay_002177_21	euxassay_002177_22	euxassay_002177_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T6017
Entity Detected:	Sec61g, SEC61, gamma subunit ( MGI:1202066)
Sequence:	sense strand is shown >T6017 CCACGCGTCCGCGGTTCTCTCCTGAGCTACGTGTCTCTACGCTCTCAATCCGCCATCCAACAAACATGGA TCAGGTAATGCAGTTTGTGGAGCCCAGCCGGCAGTTTGTAAAGGACTCAATTCGGCTGGTTAAAAGATGC ACCAAACCCGACAGAAAAGAATTCCAGAAGATTGCCATGGCTACAGCTATAGGATTTGCTATCATGGGAT TCATTGGCTTCTTCGTGAAACTGATCCATATACCCATTAATAACATTATTGTGGGTGGCTGAGTCCTTCT CATCATGGGACGAGTGAGCCAGAGCGGGGGAAAGGGCATGAAGTAAAGCGTTGCCTGAATGCTGTGTGGT GTTTTGTTTCTTCCTCCTTCCTATGAGGTTTTCTACTTCTCAATTAAAATAATTTCAAAATAAACACTTT TTCCATAACAGAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:3487721 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3487721 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:19367 same embryo
	EMAGE:19368 same embryo
	EMAGE:19370 same embryo
	EMAGE:19366 same embryo
	EMAGE:19369 same embryo
	EurExpress:euxassay_002177 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source