Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19750

March1 membrane-associated ring finger (C3HC4) 1 ( MGI:1920175)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750
"Pseudo-wholemount" of euxassay_006253. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006253_01 euxassay_006253_02 euxassay_006253_03 euxassay_006253_04
EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750
euxassay_006253_05 euxassay_006253_06 euxassay_006253_07 euxassay_006253_08 euxassay_006253_09
EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750
euxassay_006253_10 euxassay_006253_11 euxassay_006253_12 euxassay_006253_13 euxassay_006253_14
EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750
euxassay_006253_15 euxassay_006253_16 euxassay_006253_17 euxassay_006253_18 euxassay_006253_19
EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750 EMAGE:19750
euxassay_006253_20 euxassay_006253_21 euxassay_006253_22 euxassay_006253_23 euxassay_006253_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19750Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19750_wholemount_strong.wlz
19750_wholemount_moderate.wlz
19750_wholemount_weak.wlz
19750_wholemount_possible.wlz
19750_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19750_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
adenohypophysis
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 10 11 14
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 20 21
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 06 07 08 09 10 13 14 15 18 19 20 21 22 23 24 moderate expression: see section 11 12
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 12 16 17 18
hindbrain
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 17 weak expression: see section 18
spinal cord
strong strong
homogeneousstrong expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T723
Entity Detected:March1, membrane-associated ring finger (C3HC4) 1 ( MGI:1920175)
Sequence:sense strand is shown

>T723
TCCTCGAGNCTGTTGGCCTACTGGAGATTCATGAACCTCACTATGAGCAACATGACCAGCAGCCACATTT
GCTGTAATTTTTTAAATATGTGGAAAAAAAGCAAGATATCAACCATGTATTACCTTAACCAAGATGCCAA
ATTATCTAACTTGTTTCTCCAGGCAAGCAGCCCAACGACAGGGACAGCTCCCAGGAGCCAGTCAAGGTTG
TCTGTCTGTCCATCTACTCAGGACATCTGCAGGATCTGTCACTGCGAAGGAGATGAAGAGAGCCCACTCA
TCACACCCTGTCGCTGCACAGGAACCTTGCGCTTTGTCCACCAGTCCTGCCTCCACCAATGGATCAAGAG
CTCAGACACACGATGCTGTGAGCTCTGCAAGTATGACTTCATAATGGAGACCAAGCTCAAGCCCCTTCGG
AAGTGGGAAAAGCTCCAGATGACCACGAGCGAAAGGAGGAAAATATTCTGCTCTGTCACGTTCCACGTCA
TCGCCGTCACCTGTGTGGTGTGGTCCTTGTATGTGTTGATAGATCGGACAGCGGAG
Notes:The probe template was PCR amplified from IMAGE:1890205 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890205 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19751 same embryo
 EMAGE:19749 same embryo
 EMAGE:19753 same embryo
 EMAGE:19752 same embryo
 EurExpress:euxassay_006253 same experiment
 MGI:4826101 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS