Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:198

Actc1 actin, alpha, cardiac muscle 1 ( MGI:87905)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:198 EMAGE:198
Fig8C of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig8A of Moens et al., 1993 [PMID:8287798] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: no stars
Notes:
Image A shows a bright-field photomicrograph of a haematoxylin and eosin-stained parasagittal section of a wild-type ventricle in an approximately corresponding section to image C. Abbreviations used: C, compact subepicardial layer; T, trabeculae; Ep, epicardium
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart
detected detected
homogeneousAlpha-cardiac actin is expressed in both the trabeculae and the compact layer.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1276342
Entity Detected:Actc1, actin, alpha, cardiac muscle 1 ( MGI:87905)
Sequence:sense strand is shown

>MGI:1276342
AGGCGACTGACACCCAGTGCCTGCCACCAGCGCCAGCCCAGCTGAATCCAGCCGCCCCTAGCACGGTGAG
TCCCAGCCTTGCTCCCTGCAGGACCTTGTCAGCACTGTGCTTTTGTGCTCTTGGATCC
nt 662 - nt 789 of M59866.1
Notes:The probe used in this study by Moens et al., 1993 [PMID:8287798] , was originally described by Sassoon et al., 1988 [PMID:3075543] as a BamHI genomic fragment which includes the first non-coding exon (see Fig 1B therein). NB. Note that the target sequence for this probe is the reverse and compliment of the sequence in the link above (the sequence in M59866 is the reverse strand).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:10% formalin
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Moens et al., 1993 [PMID:8287798] . Indexed by GXD.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8287798] Moens CB, Stanton BR, Parada LF, Rossant J 1993 Defects in heart and lung development in compound heterozygotes for two different targeted mutations at the N-myc locus. Development (119):485-99
 [ PMID:3075543] Sassoon DA, Garner I, Buckingham M 1988 Transcripts of alpha-cardiac and alpha-skeletal actins are early markers for myogenesis in the mouse embryo. Development (104):155-64
Links:MGI:1276360 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI