Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19890

Rcc2 regulator of chromosome condensation 2 ( MGI:1919784)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890
"Pseudo-wholemount" of euxassay_006452. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006452_01 euxassay_006452_02 euxassay_006452_03 euxassay_006452_04
EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890
euxassay_006452_05 euxassay_006452_06 euxassay_006452_07 euxassay_006452_08 euxassay_006452_09
EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890
euxassay_006452_10 euxassay_006452_11 euxassay_006452_12 euxassay_006452_13 euxassay_006452_14
EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890
euxassay_006452_15 euxassay_006452_16 euxassay_006452_17 euxassay_006452_18 euxassay_006452_19
EMAGE:19890 EMAGE:19890 EMAGE:19890 EMAGE:19890
euxassay_006452_20 euxassay_006452_21 euxassay_006452_22 euxassay_006452_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19890Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19890_wholemount_strong.wlz
19890_wholemount_moderate.wlz
19890_wholemount_weak.wlz
19890_wholemount_possible.wlz
19890_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19890_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 09 10 moderate expression: see section 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 15 16 17 18
vibrissa
strong strong
regionalstrong expression: see section 07 08 21 22 moderate expression: see section 05 06 09 20 23
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 16 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 20 moderate expression: see section 03 04 05 06 09 10 15 16 17 18 19 weak expression: see section 07 08
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 20 moderate expression: see section 03 04 05 06 09 17 18 19 weak expression: see section 07
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 11 17 weak expression: see section 10
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 16 17 18 19
esophagus
moderate moderate
regionalmoderate expression: see section 10
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08
hindgut
weak weak
regionalweak expression: see section 11 12
rectum
weak weak
regionalweak expression: see section 11
midgut
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22 23
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 14 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 08 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 08 19
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11
liver right lobe
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14 15 16 17
testis
moderate moderate
regionalmoderate expression: see section 04 05 06 07 16 17 18
urethra of male
weak weak
regionalweak expression: see section 11 12
left lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21
trachea
moderate moderate
regionalmoderate expression: see section 10 11
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 06 07 21 weak expression: see section 05 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35078
Entity Detected:Rcc2, regulator of chromosome condensation 2 ( MGI:1919784)
Sequence:sense strand is shown

>T35078
AAGGAAGTGCCTAAACAGCAAGCTGCGTACCGCAACCTTGGTCAGAATTTGTGGGGGCCCCATAGGTATG
GGTGCCTGTCAGGAGTCCGGGTGCGAACCGTGGTTTCAGGCTCATGTGCTGCCCACAGCCTCCTCATCAC
CACAGAAGGGAAGCTGTGGAGCTGGGGTCGGAATGAGAAGGGGCAGCTGGGCCATGGTGATACCAAGAGG
GTGGAAGCCCCCAGACTCATCGAGGCCCTCAGCCATGAGGCAATCGTGCTGGCAGCCTGTGGGCGCAACC
ACACCCTGGCCTTGACAGATACTGGATCAGTGTTTGCCTTCGGAGAGAATAAAATGGGGCAGCTGGGTCT
CGGGAACCAGACAGATGCCGTCCCAAGTCCTGCTCAGATAATGTACAACGGGCAGCCAATCACCAAGATG
GCCTGCGGGGCCGAGTTCAGCATGCTGATGGACTGTAAAGGAAACCTCTACTCCTTTGGGTGCCCTGAGT
ATGGCCAGCTGGGGCACAACTCAGATGGCAAGTTCATCGCCCGGGCGCAGAGGATAGAATATGATTGTGA
GCTGGTGCCCCGCAGAGTGGCCATCTTCATCGAGAAGACCAAGGACGGGCAGATCTTACCTGTCCCCAAC
GTGGTGGTTCGAGATGTAGCCTGTGGCGCTAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68037. Forward Primer - name:068037_F_cDNA_2610510H01Rik, sequence:AAGGAAGTGCCTAAACAGCAAG; Reverse Primer - name:068037_N_SP6_cDNA_2610510H01Rik, sequence:GTTAGCGCCACAGGCTACATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19893 same embryo
 EMAGE:19894 same embryo
 EMAGE:19891 same embryo
 EMAGE:19892 same embryo
 EurExpress:euxassay_006452 same experiment
 MGI:4827664 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS