Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19913

Adamtsl2 ADAMTS-like 2 ( MGI:1925044)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913
"Pseudo-wholemount" of euxassay_009340. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009340_01 euxassay_009340_02 euxassay_009340_03 euxassay_009340_04
EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913
euxassay_009340_05 euxassay_009340_06 euxassay_009340_07 euxassay_009340_08 euxassay_009340_09
EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913
euxassay_009340_10 euxassay_009340_11 euxassay_009340_12 euxassay_009340_13 euxassay_009340_14
EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913
euxassay_009340_15 euxassay_009340_16 euxassay_009340_17 euxassay_009340_18 euxassay_009340_19
EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913 EMAGE:19913
euxassay_009340_20 euxassay_009340_21 euxassay_009340_22 euxassay_009340_23 euxassay_009340_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19913Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19913_wholemount_strong.wlz
19913_wholemount_moderate.wlz
19913_wholemount_weak.wlz
19913_wholemount_possible.wlz
19913_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19913_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
weak weak
regionalweak expression: see section 01 02 03
upper leg muscle
weak weak
regionalweak expression: see section 02 03 04 05 19 20
hand
weak weak
regionalweak expression: see section 01 02 09 24
foot
weak weak
regionalweak expression: see section 05 06 07 08 10 22 23 24
lower leg rest of mesenchyme
weak weak
regionalweak expression: see section 03 04 05
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21 22 23 24
brain
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14
heart valve
moderate moderate
regionalmoderate expression: see section 11 12 13
tongue muscle
weak weak
regionalweak expression: see section 12 13 14 15 16 17
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23
tail mesenchyme
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18
tail paraxial mesenchyme
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35844
Entity Detected:Adamtsl2, ADAMTS-like 2 ( MGI:1925044)
Sequence:sense strand is shown

>T35844
GCTATGATGGTGTTGAAGTGGATGACAGCTACTGCGATGCCCTCACCCGTCCTGAGCCTGTCCACGAATT
CTGCGCTGGGAGGGAGTGCCAGCCCAGGTGGGAGACCAGCAGCTGGAGTGAGTGCTCACGTACCTGTGGT
GAGGGCCATCAGTTCCGCATCGTGCGCTGCTGGAAGATGCTGTCCCCTGGATTTGACAGCTCCGTGTACA
GTGACCTCTGTGAAGCCACGGAGGCTGTCCGGCCGGAGGAACGCAAGACATGCCGCAACCCAGCCTGCGG
ACCACAGTGGGAGATGTCTGAGTGGTCAGAGTGCACTGCCAAGTGTGGAGAGCGCAGTGTAGTGACCAGA
GACATCCGCTGTTCCGAGGACGAGAAACTGTGTGACCCCAGCACCAAGCCTGTGGGAGAGAAGAACTGCA
CTGGGCCTCCCTGTGACCGCCAGTGGACTGTCTCGGACTGGGGACCGTGCAGTGGGAGCTGTGGACAGGG
CCGCACTATCAGGCATGTGTACTGTAAGACCAGCGATGGACGGGTAGTTCCCGAGTCTCAGTGCCAGACA
GAGACAAAGCCTCTGGCTATCCACCCCTGTGGGGACAAGAACTGCCCAGCACACTGGCTGGCTCAAGACT
GGGAAAGGTGCAATACCACCTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76362. Forward Primer - name:076362_F_cDNA_A930008K15Rik, sequence:GCTATGATGGTGTTGAAGTGGA; Reverse Primer - name:076362_N_SP6_cDNA_A930008K15Rik, sequence:ACAGGTGGTATTGCACCTTTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19917 same embryo
 EMAGE:19915 same embryo
 EMAGE:19914 same embryo
 EMAGE:19916 same embryo
 EMAGE:19912 same embryo
 EurExpress:euxassay_009340 same experiment
 MGI:4822992 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS