Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19917

A130014H13Rik RIKEN cDNA A130014H13 gene ( MGI:2442428)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917
"Pseudo-wholemount" of euxassay_009293. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009293_01 euxassay_009293_02 euxassay_009293_03 euxassay_009293_04
EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917
euxassay_009293_05 euxassay_009293_06 euxassay_009293_07 euxassay_009293_08 euxassay_009293_09
EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917
euxassay_009293_10 euxassay_009293_11 euxassay_009293_12 euxassay_009293_13 euxassay_009293_14
EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917
euxassay_009293_15 euxassay_009293_16 euxassay_009293_17 euxassay_009293_18 euxassay_009293_19
EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917 EMAGE:19917
euxassay_009293_20 euxassay_009293_21 euxassay_009293_22 euxassay_009293_23 euxassay_009293_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19917Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19917_wholemount_strong.wlz
19917_wholemount_moderate.wlz
19917_wholemount_weak.wlz
19917_wholemount_possible.wlz
19917_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19917_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
single cellmoderate expression: see section 10 11 13 14 weak expression: see section 12
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 weak expression: see section 12 14 15 16 17 18 19
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 03 24
corpus striatum
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 17 18 19 20 21 weak expression: see section 02 03 04
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 13 14 15 16 17 weak expression: see section 06 07 08
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19
dorsal grey horn
moderate moderate
single cellmoderate expression: see section 09 10 11 13 14 weak expression: see section 08 12
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 16 17 weak expression: see section 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35800
Entity Detected:A130014H13Rik, RIKEN cDNA A130014H13 gene ( MGI:2442428)
Sequence:sense strand is shown

>T35800
CTAGGAGTTGGTTGCTCAGCTTCCTCTGAGTGGCTGCTGGCTTTCTCTGTTCCTACTTCGTGTGTTCACA
CCAGGGCCAGTGAGAGCAGACCCTGAGATGCCCAGGCCGTGGGCACCAGTGCCCCTCATCCCTATGTGGC
ACGGTCCCCCAATTCTTGGGCCTCTGGAACAGACCAGAAGCTTCGTATTATGATTTGTGCCTATCTACAT
GGTACCACCACGGGGCATCATGCTTTTGAAGTCTAATCTGCCCTCACCTGCATCTTGTGTCTCTACCAAA
CCGGAAAAAGAATCTTAATTTCCTGTCGGGCTGGGAGGAGGCGGGTTAGAGTCAGGATAATGACTCTTAA
ATATGAGCAATGCGTCTGGTTCCATGTTATTTTTCCTCTACCCTCTTAATACACAAGATTTGTTTATCAT
GCTTAAAACAAAGTAGCTGGGCAAATATTTAAGTGATCAGAAACAAATGTTTTTATTAGCCTGGCGTGCG
AAATGGGTTATCTGCCTATCTTGTTTACGAAATCCGGGGCTGCCTTCCCGCACAGTATGCTCGCCTCTCG
AATCTTCCCCGGCTCCCATTTCCATATTTCTGCGTGCTTGTTCTTTGTTAATCACTTGGCAAGCGCTTAT
TTGAATATTAAAAATTTCTTTAATCATCAAACGCAGGAGCACAGTCTCATGAATATTCATATTCTCCCCC
CCTCCTCAGACTGGATTTTAGTTCATTACCCCGCAGTAAAAGCCAAACAGCCATCAATCGCTCTCATTAC
TGGCTCTGGCGTTTTGATTGGCTGCCTGCTGCCCATAGACCCTTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69137. Forward Primer - name:069137_F_cDNA_A130014H13Rik, sequence:CTAGGAGTTGGTTGCTCAGCTT; Reverse Primer - name:069137_N_SP6_cDNA_A130014H13Rik, sequence:AAAAGGGTCTATGGGCAGCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19915 same embryo
 EMAGE:19914 same embryo
 EMAGE:19916 same embryo
 EMAGE:19912 same embryo
 EMAGE:19913 same embryo
 EurExpress:euxassay_009293 same experiment
 MGI:4822817 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS