Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19929

Myo10 myosin X ( MGI:107716)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929
"Pseudo-wholemount" of euxassay_009373. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009373_01 euxassay_009373_02 euxassay_009373_03 euxassay_009373_04
EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929
euxassay_009373_06 euxassay_009373_07 euxassay_009373_08 euxassay_009373_09 euxassay_009373_10
EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929
euxassay_009373_11 euxassay_009373_12 euxassay_009373_13 euxassay_009373_14 euxassay_009373_15
EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929
euxassay_009373_16 euxassay_009373_17 euxassay_009373_18 euxassay_009373_19 euxassay_009373_20
EMAGE:19929 EMAGE:19929 EMAGE:19929 EMAGE:19929
euxassay_009373_21 euxassay_009373_22 euxassay_009373_23 euxassay_009373_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19929Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19929_wholemount_strong.wlz
19929_wholemount_moderate.wlz
19929_wholemount_weak.wlz
19929_wholemount_possible.wlz
19929_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19929_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 02 03 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 06
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13
rest of cerebellum mantle layer
moderate moderate
single cellmoderate expression: see section 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17 18 moderate expression: see section 06
pons mantle layer
moderate moderate
single cellmoderate expression: see section 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 06
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain marginal layer
moderate moderate
single cellmoderate expression: see section 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 06 07 08 09 18 19 20 21
spinal cord mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36658
Entity Detected:Myo10, myosin X ( MGI:107716)
Sequence:sense strand is shown

>T36658
CCCTATGGGGACATAAATCTCAACCTGCTGAAAGACAAAGGCTACACGACCCTTCAGGACGAAGCCATCA
AGATATTCAATTCTCTCCAACAACTGGAGTCCATGTCCGACCCCATCCCTATCATCCAGGGCATCCTGCA
GACCGGGCACCACCTCCGGCCTCTGCGGGATGAACTGTATTGTCAGCTCATCAAACAGACCAACAAGGTC
CCCCATCCCGGCAGCGTGGGCAACCTTTACAGCTGGCAGATCCTGACCTGCCTCAGCTGCACCTTCCTGC
CTAGCCTCGGGATCCTCAAATACCTCAAGTTCCACCTGAAAAGGATACGGGAACAGTTCCCAGGAACCGA
GATGGAGAAGTACGCCCTCTTTATCTACGAATCCCTTAAGAAAACCAAATGCAGAGAGTTTGTGCCTTCC
CGAGATGAAATCGAAGCTCTGATCCACCGGCAGGAAATGACGTCCACAGTGTATTGCCATGGCGGAGGCT
CCTGCAAGATCACCATCAACTCCCACACCACAGCCGGGGAGGTGGTGGAGAAGCTGATCCGAGGGCTCGC
CATGGAGGACAGCAGGAACATGTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100374. Forward Primer - name:100374_F_cDNA_Myo10, sequence:CCCTATGGGGACATAAATCTCA; Reverse Primer - name:100374_N_SP6_cDNA_Myo10, sequence:AAACATGTTCCTGCTGTCCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19932 same embryo
 EMAGE:19931 same embryo
 EMAGE:19930 same embryo
 EurExpress:euxassay_009373 same experiment
 MGI:4826556 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS