Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19932

Myl1 myosin, light polypeptide 1 ( MGI:97269)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932
"Pseudo-wholemount" of euxassay_009372. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009372_01 euxassay_009372_02 euxassay_009372_03 euxassay_009372_04
EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932
euxassay_009372_05 euxassay_009372_06 euxassay_009372_07 euxassay_009372_08 euxassay_009372_09
EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932
euxassay_009372_10 euxassay_009372_11 euxassay_009372_12 euxassay_009372_13 euxassay_009372_14
EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932
euxassay_009372_15 euxassay_009372_16 euxassay_009372_17 euxassay_009372_18 euxassay_009372_19
EMAGE:19932 EMAGE:19932 EMAGE:19932 EMAGE:19932
euxassay_009372_20 euxassay_009372_21 euxassay_009372_22 euxassay_009372_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19932Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19932_wholemount_strong.wlz
19932_wholemount_moderate.wlz
19932_wholemount_weak.wlz
19932_wholemount_possible.wlz
19932_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19932_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
upper leg muscle
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 22 23
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01
hand
strong strong
regionalstrong expression: see section 02 03 04 05
foot
strong strong
regionalstrong expression: see section 10 11 22 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 17 18 19 20 21 22 23
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36657
Entity Detected:Myl1, myosin, light polypeptide 1 ( MGI:97269)
Sequence:sense strand is shown

>T36657
TCTGGAGGAGATCCTTCTTTTGTTAACCCATCCTTTTAATCAAAATGGCACCAAAGAAAGACGTGAAGAA
GCCCGCTGCTGCGCCTGCCCCAGCCCCGGCCCCGGCCCCTGCCCCAGCCAAACCTAAGGAAGAAAAAATC
GATCTGTCTGCTATTAAGATCGAGTTCTCTAAGGAGCAACAGGAGGACTTCAAGGAGGCATTTCTCCTGT
TTGACAGAACAGGTGAATGCAAGATCACCTTAAGTCAGGTGGGAGACGTCCTCCGGGCTCTGGGCACCAA
TCCCACCAATGCAGAGGTCAAGAAGGTTCTTGGGAACCCCAGCAATGAAGAGATGAATGCTAAGAAAATC
GAGTTTGAACAGTTTCTGCCCATGATGCAAGCTATCTCCAACAACAAGGACCAGGGAGGTTATGAAGATT
TCGTTGAGGGTCTGCGTGTCTTCGACAAGGAGGGCAATGGCACCGTCATGGGTGCTGAACTCCGCCATGT
CCTCGCCACTCTGGGAGAGAAGATGAAGGAGGAAGAGGTAGAAGCGTTGCTGGCAGGCCAGGAGGACTCC
AATGGCTGCATCAACTATGAAGCTTTTGTCAAACACATCATGTCTGTCTAAACGGAGTTTTCAAGCACGC
AATGTTGGGGAAGACTGGCCAGTTCAAGAACACCTATGGCTAACTGTCAACACCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90231. Forward Primer - name:090231_F_cDNA_Myl1, sequence:TCTGGAGGAGATCCTTCTTTTG; Reverse Primer - name:090231_N_SP6_cDNA_Myl1, sequence:TGGTGTTGACAGTTAGCCATAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19929 same embryo
 EMAGE:19931 same embryo
 EMAGE:19930 same embryo
 EurExpress:euxassay_009372 same experiment
 MGI:4826547 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS