Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19933

Snhg11 small nucleolar RNA host gene 11 ( MGI:2441845)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933
"Pseudo-wholemount" of euxassay_009334. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009334_01 euxassay_009334_02 euxassay_009334_03 euxassay_009334_04
EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933
euxassay_009334_05 euxassay_009334_06 euxassay_009334_07 euxassay_009334_08 euxassay_009334_09
EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933
euxassay_009334_10 euxassay_009334_11 euxassay_009334_12 euxassay_009334_13 euxassay_009334_14
EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933 EMAGE:19933
euxassay_009334_15 euxassay_009334_16 euxassay_009334_17 euxassay_009334_18 euxassay_009334_19
EMAGE:19933 EMAGE:19933 EMAGE:19933
euxassay_009334_20 euxassay_009334_21 euxassay_009334_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19933Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19933_wholemount_strong.wlz
19933_wholemount_moderate.wlz
19933_wholemount_weak.wlz
19933_wholemount_possible.wlz
19933_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19933_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 15 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 15 16
spinal cord mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13
cervico-thoracic ganglion
strong strong
single cellstrong expression: see section 08 14
cervical ganglion
strong strong
single cellstrong expression: see section 07 08 15
thoracic ganglion
strong strong
single cellstrong expression: see section 08 09 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 11 12 13 14 15 16
neural retina
strong strong
regionalstrong expression: see section 01 02 03 20 21 22
tongue
strong strong
spottedstrong expression: see section 11 13
stomach
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07
midgut
moderate moderate
spottedmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35851
Entity Detected:Snhg11, small nucleolar RNA host gene 11 ( MGI:2441845)
Sequence:sense strand is shown

>T35851
CCTCCTGGAGTACTGGAAAAGAGATCGTTGGGTTCTCGGACTGTTGACCTGCGTCCTTCCAAGCTGATAA
GCCCAGGACCCTAGGACGGGATGCTAGGACTCCTGTGTGGCGCCTTGCTTTGAACCCTTTCCCAAGGGCT
GTTTCCCAGATGAGCCTTTGCCGCAAGGCCCTCTTGACACCAAGGATGACGACGCAAAACCTGCGGCAGC
CAACACCCCTCTCCCCACTCTCCGCACTCACTGGTGGGTTGCCACCATCCAGGAAGCAAGTATCCCGAAT
TGACAGCTTGGTGCAGAGGGGACATGAGAGGTGTCTCTGTCCAGCTAGGAAGCAGCTGGACCACAGCGCT
CCCAAGGAACGTACTCCCCAACATCAGTGTGGAGCGACCAGAGAGCATGACCATCTCGCAGTGATCGCCT
GCAGGGGCCTTAGCCAGGTGATGGTGGTGGTACCCAGGAAGAGCAAGGTTGCTGGCACGCAACATGCCTG
CAGCCCTTGATGCTGTTGGCTCACCAGCACGGAGCACCTTTTTACTTTGGTAGGTATGCAGAGGGAAGGG
CCTTGACTCTGGAGACTTGGGGACCAAAGTTAGAGACTCGCTAGGTCTGTCCCTCCCTTTAGAGCCACAG
AATGCCACGTGGCACTGAGGTTCTTGCTCTCACAAATAAGCACTCGGGAAACCAGCCGTGTTAAACACGC
AGGTTGTCTCTTCAAAGGGAGAGACATATATCCTGTTTTCCTCCCAGAAGGCTGGGAGCGGAGGTGTTTA
ATATCCTGGCGAACTTTGTGCTATCTGTATGACCAAGACCATGTCAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68972. Forward Primer - name:068972_F_cDNA_A930034L06Rik, sequence:CCTCCTGGAGTACTGGAAAAGA; Reverse Primer - name:068972_N_SP6_cDNA_A930034L06Rik, sequence:TCTGACATGGTCTTGGTCATAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19936 same embryo
 EMAGE:19937 same embryo
 EMAGE:19938 same embryo
 EMAGE:19935 same embryo
 EMAGE:19934 same embryo
 EurExpress:euxassay_009334 same experiment
 MGI:4828348 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS