Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19993

Sgol2 shugoshin-like 2 (S. pombe) ( MGI:1098767)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993
"Pseudo-wholemount" of euxassay_009464. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009464_01 euxassay_009464_02 euxassay_009464_03 euxassay_009464_04
EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993
euxassay_009464_05 euxassay_009464_06 euxassay_009464_07 euxassay_009464_08 euxassay_009464_09
EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993
euxassay_009464_10 euxassay_009464_11 euxassay_009464_12 euxassay_009464_13 euxassay_009464_14
EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993 EMAGE:19993
euxassay_009464_15 euxassay_009464_16 euxassay_009464_17 euxassay_009464_18 euxassay_009464_19
EMAGE:19993 EMAGE:19993 EMAGE:19993
euxassay_009464_20 euxassay_009464_21 euxassay_009464_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19993Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19993_wholemount_strong.wlz
19993_wholemount_moderate.wlz
19993_wholemount_weak.wlz
19993_wholemount_possible.wlz
19993_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19993_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 12 14 weak expression: see section 11
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 16 17
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 14 15 16 17 18 19 20 21 weak expression: see section 02 03 04 05 06 07 22
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 12 13 14 weak expression: see section 06 07 11 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37015
Entity Detected:Sgol2, shugoshin-like 2 (S. pombe) ( MGI:1098767)
Sequence:sense strand is shown

>T37015
AGAGCAGACTAACCTGCCAAAGATGCAGAAACAAAGCGCTGGGAGGTCACTGGGAGATGCTTTCTCTGTG
AGTCTGGGAAAAGAAGGAAGCCGCCCAGCCAAAGCAGTTAGTAAAATGACACCCAAATCAAAGAAGAGAA
AGCTCCCTCTCGGTTGTTCTCCTGAAACCCACGGGACGGTGGAGATAACACCCAACACTGACCTCGCTAA
GGCTGTTGACTCCCAACAGACTGAGAAGGAGAACTATTTGGAGAAGGAGAAAATTGCCAAGAGGAAGCCA
GATTTTTGTACAAAGGTGTTGAAACCTTTATCTGAGACATGTTCATCTAACATAAAGAATTCTTCCTTGG
ACAGTATGTGTAAGAGTTCGCTACCTTTGAGTATTTCTTCTAGAAAAACCCTGATGCTGGAAGAAAGTTC
TTCCCTGGAGAGTACATGCATCTTTCAAGTAGGTGATGCCGCTCATGAGAAGATAACGACAGGCACACGT
AATCCCCACCACAGGACACAGAAGTCGACACCGGGTAGCAGAACGTCCCTGGTCTTGGTGGATACCAGTT
CTGTTTCAGATACCAACCCTGCTAACCCCGAGAATGAGTCAGAAGGGCAGTCTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88516. Forward Primer - name:088516_F_cDNA_Sgol2, sequence:AGAGCAGACTAACCTGCCAAAG; Reverse Primer - name:088516_N_SP6_cDNA_Sgol2, sequence:GAAGACTGCCCTTCTGACTCAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19996 same embryo
 EMAGE:19998 same embryo
 EMAGE:19994 same embryo
 EMAGE:19995 same embryo
 EMAGE:19997 same embryo
 EurExpress:euxassay_009464 same experiment
 MGI:4828028 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS