Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19996

Shb src homology 2 domain-containing transforming protein B ( MGI:98294)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996
"Pseudo-wholemount" of euxassay_009465. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009465_01 euxassay_009465_02 euxassay_009465_03 euxassay_009465_04
EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996
euxassay_009465_05 euxassay_009465_06 euxassay_009465_07 euxassay_009465_08 euxassay_009465_09
EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996
euxassay_009465_10 euxassay_009465_11 euxassay_009465_12 euxassay_009465_13 euxassay_009465_14
EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996
euxassay_009465_15 euxassay_009465_16 euxassay_009465_17 euxassay_009465_18 euxassay_009465_19
EMAGE:19996 EMAGE:19996 EMAGE:19996 EMAGE:19996
euxassay_009465_20 euxassay_009465_21 euxassay_009465_22 euxassay_009465_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19996Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19996_wholemount_strong.wlz
19996_wholemount_moderate.wlz
19996_wholemount_weak.wlz
19996_wholemount_possible.wlz
19996_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19996_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 15 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 15 16 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 15 16 17 weak expression: see section 05 06 07
neural retina
weak weak
regionalweak expression: see section 02 03 04 05 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 17 moderate expression: see section 10 11 12 13 15 16 18 19
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 20
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37017
Entity Detected:Shb, src homology 2 domain-containing transforming protein B ( MGI:98294)
Sequence:sense strand is shown

>T37017
TGATGACTACTCCGATCCCTTTGATGCCAAGAGCGACCTCAAGAGCAAAGCAGGAAAGGGTGAGAGCGCT
GGCTACATGGAGCCCTACGAAGCCCAGAGGATCATGACAGAATTCCAGAGGCAAGAGAGCGTCCGGTCAC
AGCACAAAGGCATCCAGTTGTACGACACCCCGTACGAGCCGGAAGGCCAGAGCGTGGACTCAGACTCAGA
GAGCACTGTGAGCCTTCGGCTGCGGGAGAGCAAGCTACCCCAGGATGACGACAGGCCTGCTGATGAGTAC
GACCAGCCGTGGGAATGGAACCGGGTCACCATCCCCGCCCTGGCAGCCCAGTTTAACGGCAATGAAAAGC
GGCAGTCCTCCCCATCACCTTCTCGGGACCGACGGCGCCAGCTCCGTGCCCCGGGAGGAGGCTTCAAGCC
CATCAAGCACGGGAGCCCCGAGTTCTGTGGGATTCTGGGGGAGAGAGTGGATCCCACCATCCCACTGGAG
AAACAGATATGGTATCACGGGGCCATCAGCAGAAGTGATGCTGAGAACCTGCTGCGACTCTGTAAGGAGT
GCAGCTACCTTGTCCGGAACAGCCAGACCAGCAAACATGACTACTCCCTCTCCCTGAAGAGTAACCAGGG
CTTCATGCACATGAAACTGGCCAAGACCAAAGAGAAGTATGTTCTGGGTCAGAACAGCCCCCCTTTTGAC
AGCGTCCCGGAAGTCATCCACTACTACACCACCAGGAAGCTGCCCATCAAAGGGGCCGAGCACTTGTCCC
TCCTCTACCCAGTGGCTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77867. Forward Primer - name:077867_F_cDNA_Shb, sequence:TGATGACTACTCCGATCCCTTT; Reverse Primer - name:077867_N_SP6_cDNA_Shb, sequence:CACAGCCACTGGGTAGAGGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19993 same embryo
 EMAGE:19998 same embryo
 EMAGE:19994 same embryo
 EMAGE:19995 same embryo
 EMAGE:19997 same embryo
 EurExpress:euxassay_009465 same experiment
 MGI:4828048 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS