Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19998

Shc3 src homology 2 domain-containing transforming protein C3 ( MGI:106179)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998
"Pseudo-wholemount" of euxassay_009466. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009466_01 euxassay_009466_02 euxassay_009466_03 euxassay_009466_04
EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998
euxassay_009466_05 euxassay_009466_06 euxassay_009466_07 euxassay_009466_08 euxassay_009466_09
EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998
euxassay_009466_10 euxassay_009466_11 euxassay_009466_12 euxassay_009466_13 euxassay_009466_14
EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998
euxassay_009466_15 euxassay_009466_16 euxassay_009466_17 euxassay_009466_18 euxassay_009466_19
EMAGE:19998 EMAGE:19998 EMAGE:19998 EMAGE:19998
euxassay_009466_20 euxassay_009466_21 euxassay_009466_22 euxassay_009466_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19998Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19998_wholemount_strong.wlz
19998_wholemount_moderate.wlz
19998_wholemount_weak.wlz
19998_wholemount_possible.wlz
19998_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19998_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 11 12 16 17
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 weak expression: see section 23
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19 moderate expression: see section 20
pons ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 14 15 16 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 12 14
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12
cochlear duct
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37018
Entity Detected:Shc3, src homology 2 domain-containing transforming protein C3 ( MGI:106179)
Sequence:sense strand is shown

>T37018
CTATGTCGCTAAGGACCCTGTCAATCGCAGAGCTTGCCACATTCTGGAATGCTGTGACGGGCTAGCCCAA
GATGTCATTGGCTCCATCGGACAAGCCTTTGAACTCCGGTTCAAACAGTATTTGCAGTGCCCTTCCAAGG
TTCCTGCCCTCCAGGACCGAATGCAGAGTCTGGATGAGCCATGGACTGAAGAAGAGGGAGATGGCCCTGA
TCACCCATACTACAACAGCGTTCCCACCAAGATGCCTCCCCCAGGGGGGTTTCTGGATGCTCGATTGAAA
GGCAGACCCCACGCTCCTGAGGCAGCCCAGTTTGCAGGAAAAGAGCAAACTTATTACCAGGGAAGACACT
TAGGAGATACATTTGGTGAAGACTGGCAGCGAGCACCCACCAGGCAAGGCTCCTTGGACATCTATAGCAC
AGCAGAAGGGAAAACTCACATGGTTCCTGTAGGAGAAACACCAACCTATGTCAACACCCAGCCAGTCCCA
CCACAGGTGTGGCCAGCAGCAACCAGCAGCACTGAGAGCAGCCCACGGAAGGACCTCTTTGACATGAAGC
CCTTTGAAGATGCCCTGAGAAACCAGCCCCTGGGCCCCATGTTGAGCAAAGCCGCGTCTGTGGAGTGCAT
CAGCCCGGTCACACCCAGAGCCCCGGATGCCAGGATGCTGGAGGAGCTTAACGCTGAGCCCTGGTACCAA
GGAGAGATGAGCAGGAAGGAGGCAGAGGCCCTGCTACGGGAAGATGGAGACTTCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74102. Forward Primer - name:074102_F_cDNA_Shc3, sequence:CTATGTCGCTAAGGACCCTGTC; Reverse Primer - name:074102_N_SP6_cDNA_Shc3, sequence:AGGAAGTCTCCATCTTCCCGTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19993 same embryo
 EMAGE:19996 same embryo
 EMAGE:19994 same embryo
 EMAGE:19995 same embryo
 EMAGE:19997 same embryo
 EurExpress:euxassay_009466 same experiment
 MGI:4828050 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS