Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20028

Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 ( MGI:1347355)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028
"Pseudo-wholemount" of euxassay_012149. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012149_01 euxassay_012149_02 euxassay_012149_03 euxassay_012149_04
EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028
euxassay_012149_05 euxassay_012149_06 euxassay_012149_07 euxassay_012149_08 euxassay_012149_09
EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028
euxassay_012149_10 euxassay_012149_11 euxassay_012149_12 euxassay_012149_13 euxassay_012149_14
EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028
euxassay_012149_15 euxassay_012149_16 euxassay_012149_17 euxassay_012149_18 euxassay_012149_19
EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028 EMAGE:20028
euxassay_012149_20 euxassay_012149_21 euxassay_012149_22 euxassay_012149_23 euxassay_012149_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20028Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20028_wholemount_strong.wlz
20028_wholemount_moderate.wlz
20028_wholemount_weak.wlz
20028_wholemount_possible.wlz
20028_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20028_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 13
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
choroid invagination
strong strong
regionalstrong expression: see section 09 10 18 19 moderate expression: see section 08 11 12 20
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 09 10 18 moderate expression: see section 08 17 19 20 weak expression: see section 07
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain meninges
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
lens
strong strong
regionalstrong expression: see section 01
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37043
Entity Detected:Slc7a11, solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 ( MGI:1347355)
Sequence:sense strand is shown

>T37043
GTACTGTCACTTTTTGGAGCCCTGTCCTATGCAGAATTAGGTACAAGCATAAAGAAATCTGGTGGTCATT
ACACATACATTCTGGAGGTCTTTGGTCCTTTGCTGGCTTTTGTTCGAGTCTGGGTGGAACTGCTCGTAAT
ACGCCCTGGAGCTACTGCTGTGATATCCCTGGCATTTGGACGCTACATCCTGGAACCATTTTTTATTCAA
TGTGAAATTCCTGAACTTGCAATCAAGCTCGTGACAGCTGTGGGCATCACTGTGGTGATGGTCCTAAATA
GCACGAGTGTCAGCTGGAGTGCCCGGATCCAGATTTTCCTAACCTTTTGCAAGCTCACAGCAATTCTGAT
AATTATAGTCCCTGGAGTTATACAGCTAATTAAAGGGCAAACACATCACTTTAAAGATGCATTTTCAGGA
AGAGACACAAGTCTAATGGGGTTGCCCTTGGCTTTTTATTATGGGATGTATGCATATGCTGGCTGGTTTT
ACCTCAACTTTATTACTGAAGAAGTAGACAACCCTGAAAAAACCATCCCCCTTGCAATCTGCATCTCCAT
GGCTATCATCACAGTGGGCTACGTACTGACAAACGTGGCCTATTTTACCACCATCAGTGCGGAGGAGCTG
CTGCAGTCCAGCGCCGTGGCGGTGACCTTCTCTGAGCGGCTGCTGGGAAAATTCTCATTAGCAGTCCCGA
TCTTTGTTGCCCTCTCCTGCTTCGGCTCCATGAACGGTGGTGTGTTCGCTGTCTCCAGGTTATTCTACGT
CGCATCTCGAGAAGGGCACCTTCCGGAAATCCTCTCTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99689. Forward Primer - name:099689_F_cDNA_Slc7a11, sequence:GTACTGTCACTTTTTGGAGCCC; Reverse Primer - name:099689_N_SP6_cDNA_Slc7a11, sequence:ATAGAGAGGATTTCCGGAAGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20031 same embryo
 EMAGE:20030 same embryo
 EMAGE:20029 same embryo
 EMAGE:20027 same embryo
 EMAGE:20032 same embryo
 EurExpress:euxassay_012149 same experiment
 MGI:4828273 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS