Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20029

Slc9a3r1 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 ( MGI:1349482)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029
"Pseudo-wholemount" of euxassay_012152. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012152_01 euxassay_012152_02 euxassay_012152_03 euxassay_012152_04
EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029
euxassay_012152_05 euxassay_012152_06 euxassay_012152_07 euxassay_012152_08 euxassay_012152_09
EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029
euxassay_012152_10 euxassay_012152_11 euxassay_012152_12 euxassay_012152_13 euxassay_012152_14
EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029
euxassay_012152_15 euxassay_012152_16 euxassay_012152_17 euxassay_012152_18 euxassay_012152_19
EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029 EMAGE:20029
euxassay_012152_20 euxassay_012152_21 euxassay_012152_22 euxassay_012152_23 euxassay_012152_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20029Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20029_wholemount_strong.wlz
20029_wholemount_moderate.wlz
20029_wholemount_weak.wlz
20029_wholemount_possible.wlz
20029_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20029_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pleura
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 04
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 19
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18 19
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 18 19 20 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 17 18 19 20 21 22 23
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23 24
cornea epithelium
moderate moderate
regionalmoderate expression: see section 02 03 04 23 24
anterior naris epithelium
strong strong
regionalstrong expression: see section 11 12 14 15
external naris epithelium
strong strong
regionalstrong expression: see section 10 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18
vomeronasal organ
strong strong
regionalstrong expression: see section 14
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05
rectum
moderate moderate
regionalmoderate expression: see section 12
midgut
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 14 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 19 20
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urogenital mesentery
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 17 18 19 20 21 22
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 08 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37046
Entity Detected:Slc9a3r1, solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 ( MGI:1349482)
Sequence:sense strand is shown

>T37046
CCCTTCAGCAATGGAGAGATACAGAAGGAGAGCAGCCGTGAAGCCCTGGTGGAGCCAGCTTCAGAGAGCC
CCAGGCCAGCCCTGGCAAGATCTGCCTCCAGCGATACCAGTGAGGAGCTAAATTCCCAAGACAGCCCCAA
GAGACAAGTTTCCACAGAGCCCTCATCTACCTCCTCCTCCTCCTCTGACCCCATCTTGGACCTCAACATC
TCCTTGGCTGTGGCTAAAGAGAGGGCCCACCAGAAGCGCAGTAGCAAGAGGGCCCCGCAGATGGACTGGA
GCAAGAAAAATGAACTCTTCAGCAACCTCTGAGCATCCCACCTCCGTGGGCTTGTGCTAGAGGGTGGGGC
TGCCCACCCTACCTAGCTCCCCTTCCCTTCTCCCCAGGTGCCCACCAATCAACATTCAGATCAGCATCAG
CACCCACCCCACTTCCTGACAAATCTGATTTTTCTAGAATCCTGTTCTTCCCTCACCTTAGGGAAGGAGA
ATGTTTGTCCTGTCTCCCTACACTTCCCTGAGGGCTTCTTCCTACCAAAGTGTCCCCTCACCAGTCTGCC
TAGAGCATCACTGGAACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99734. Forward Primer - name:099734_F_cDNA_Slc9a3r1, sequence:CCCTTCAGCAATGGAGAGATAC; Reverse Primer - name:099734_N_SP6_cDNA_Slc9a3r1, sequence:GGGTTCCAGTGATGCTCTAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20028 same embryo
 EMAGE:20031 same embryo
 EMAGE:20030 same embryo
 EMAGE:20027 same embryo
 EMAGE:20032 same embryo
 EurExpress:euxassay_012152 same experiment
 MGI:4828289 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS