Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20036

Slc9a6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 ( MGI:2443511)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036
"Pseudo-wholemount" of euxassay_012153. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012153_01 euxassay_012153_02 euxassay_012153_04 euxassay_012153_05
EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036
euxassay_012153_06 euxassay_012153_07 euxassay_012153_08 euxassay_012153_09 euxassay_012153_10
EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036
euxassay_012153_11 euxassay_012153_12 euxassay_012153_13 euxassay_012153_14 euxassay_012153_15
EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036 EMAGE:20036
euxassay_012153_16 euxassay_012153_17 euxassay_012153_18 euxassay_012153_19 euxassay_012153_20
EMAGE:20036 EMAGE:20036 EMAGE:20036
euxassay_012153_21 euxassay_012153_22 euxassay_012153_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20036Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20036_wholemount_strong.wlz
20036_wholemount_moderate.wlz
20036_wholemount_weak.wlz
20036_wholemount_possible.wlz
20036_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20036_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 08 16 17 18 weak expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 18 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 08 17 18 19 20 21 weak expression: see section 06 07 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 17
spinal cord
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 09 10 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37048
Entity Detected:Slc9a6, solute carrier family 9 (sodium/hydrogen exchanger), member 6 ( MGI:2443511)
Sequence:sense strand is shown

>T37048
TGAAGTGCAGTCAAGTCCAACTACCTTGTTGGTCAACGTCAGTGGAAAATTTTATGAGTATACGCTGAAA
GGAGAGATTAGCTCACATGAACTCAACAATGTTCAAGATAATGAAATGCTTAGGAAGGTTACTTTTGATC
CAGAAGTCTTTTTCAACATACTGCTTCCTCCTATCATATTTTATGCAGGGTACAGTCTCAAAAGGAGACA
TTTCTTCCGGAACCTTGGGTCTATCTTAGCATATGCCTTTCTTGGAACAGCAATTTCTTGTTTCGTTATT
GGGTCCATCATGTATGGCTGTGTAACCCTGATGAAGGTGACCGGGCAGCTCGCGGGAGATTTTTACTTTA
CAGATTGCTTGCTGTTTGGTGCCATTGTTTCAGCCACCGACCCAGTGACTGTTCTTGCCATCTTCCATGA
GCTTCAAGTTGACGTTGAACTCTACGCTCTTCTCTTCGGGGAAAGTGTCCTCAATGACGCGGTTGCCATA
GTGCTGTCCTCCTCAATAGTGGCATACCAGCCAGCGGGAGACAACAGCCACACCTTTGACGTTACAGCCA
TGTTCAAATCTATTGGAATCTTCCTTGGGATCTTCAGTGGATCTTTTGCAATGGGTGCTGCAACAGGCGT
GGTAACAGCTTTAGTGACAAAGTTCACAAAGCTGAGAGAGTTCCAGCTGTTGGAGACAGGCCTTTTCTTC
TTGATGTCCTGGAGCACCTTTCTTCTGGCTGAAGCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93309. Forward Primer - name:093309_F_cDNA_Slc9a6, sequence:TGAAGTGCAGTCAAGTCCAACT; Reverse Primer - name:093309_N_SP6_cDNA_Slc9a6, sequence:ATGCTTCAGCCAGAAGAAAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20033 same embryo
 EMAGE:20035 same embryo
 EMAGE:20034 same embryo
 EurExpress:euxassay_012153 same experiment
 MGI:4828290 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS