Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20040

Slc36a1 solute carrier family 36 (proton/amino acid symporter), member 1 ( MGI:2445299)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040
"Pseudo-wholemount" of euxassay_012143. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012143_01 euxassay_012143_02 euxassay_012143_03 euxassay_012143_04
EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040
euxassay_012143_05 euxassay_012143_06 euxassay_012143_07 euxassay_012143_08 euxassay_012143_09
EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040
euxassay_012143_10 euxassay_012143_11 euxassay_012143_12 euxassay_012143_13 euxassay_012143_14
EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040 EMAGE:20040
euxassay_012143_15 euxassay_012143_16 euxassay_012143_17 euxassay_012143_18 euxassay_012143_19
EMAGE:20040 EMAGE:20040 EMAGE:20040
euxassay_012143_20 euxassay_012143_21 euxassay_012143_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20040Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20040_wholemount_strong.wlz
20040_wholemount_moderate.wlz
20040_wholemount_weak.wlz
20040_wholemount_possible.wlz
20040_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20040_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
thyroid gland
weak weak
regionalweak expression: see section 09 13
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 07 10 12 13 16 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 14 15
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 16
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 04 05 06 16 17 18 19 20
pons mantle layer
weak weak
regionalweak expression: see section 07 16 17
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 07
ventral grey horn
weak weak
regionalweak expression: see section 08 09 12 13
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 13 14
cervical ganglion
weak weak
regionalweak expression: see section 07 08 15
thoracic ganglion
weak weak
regionalweak expression: see section 10
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 14 15
lower jaw incisor
weak weak
regionalweak expression: see section 10 13 14
lower jaw molar
weak weak
regionalweak expression: see section 06 16 17 18
upper jaw incisor
weak weak
regionalweak expression: see section 10 14
upper jaw molar
weak weak
regionalweak expression: see section 06 16 17 18
urethra of male
weak weak
regionalweak expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37036
Entity Detected:Slc36a1, solute carrier family 36 (proton/amino acid symporter), member 1 ( MGI:2445299)
Sequence:sense strand is shown

>T37036
ACTCTCGACTCTACATGCCCTCCTTCCTGCCCTTCCTGGTGTTGCTGTCTTTCATCAGGAACCTGCGTGT
GTTGTCCATCTTCTCCCTGCTGGCCAACATCAGCATGTTCGTCAGCCTGATCATGATATACCAGTTCATT
GTCCAGAGGATCCCAGACCCCAGCCACCTCCCCTTGGTGGCTCCATGGAAGACCTACCCTCTGTTCTTTG
GCACAGCGATTTTTGCTTTTGAAGGCATTGGAGTGGTTCTACCCCTTGAGAACAAAATGAAGGACTCACA
GAAATTTCCATTGATTCTGTATTTGGGGATGGCTATCATCACTGTACTCTACATCAGCCTGGGGAGCCTG
GGGTACCTGCAATTTGGAGCTAATATCAAGGGCAGCATCACCCTCAACCTGCCCAACTGCTGGTTGTACC
AGTCGGTGAAGCTGCTGTACTCCATAGGCATCTTCTTCACCTATGCCCTCCAGTTCTATGTCGCAGCTGA
GATCATCATCCCGGCCATTGTGTCCCGAGTGCCTGAGCATTTCGAGCTGATGGTGGACCTTTGTGTGCGC
ACCGCCATGGTCTGTGTGACATGTGTGCTGGCCATCCTCATCCCACGCCTGGACCTGGTCATCTCCCTGG
TGGGCTCTGTGAGCAGCAGCGCCCTGGCCCTCATCATCCCGCCCCTGCTGGAGGTGGTCACCTACTATGG
AGAGGGCATTAGCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101309. Forward Primer - name:101309_F_cDNA_Slc36a1, sequence:ACTCTCGACTCTACATGCCCTC; Reverse Primer - name:101309_N_SP6_cDNA_Slc36a1, sequence:GGGCTAATGCCCTCTCCATAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20037 same embryo
 EMAGE:20042 same embryo
 EMAGE:20041 same embryo
 EMAGE:20039 same embryo
 EMAGE:20038 same embryo
 EurExpress:euxassay_012143 same experiment
 MGI:4828207 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS