Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20077

Sars seryl-aminoacyl-tRNA synthetase ( MGI:102809)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077
"Pseudo-wholemount" of euxassay_012234. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012234_01 euxassay_012234_02 euxassay_012234_03 euxassay_012234_04
EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077
euxassay_012234_05 euxassay_012234_06 euxassay_012234_07 euxassay_012234_08 euxassay_012234_09
EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077
euxassay_012234_10 euxassay_012234_11 euxassay_012234_12 euxassay_012234_13 euxassay_012234_14
EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077 EMAGE:20077
euxassay_012234_15 euxassay_012234_16 euxassay_012234_17 euxassay_012234_18 euxassay_012234_19
EMAGE:20077 EMAGE:20077 EMAGE:20077
euxassay_012234_20 euxassay_012234_21 euxassay_012234_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20077Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20077_wholemount_strong.wlz
20077_wholemount_moderate.wlz
20077_wholemount_weak.wlz
20077_wholemount_possible.wlz
20077_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20077_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 16 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15
pons mantle layer
weak weak
regionalweak expression: see section 07 16
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 16 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 08 16
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 16 17
ventral grey horn
weak weak
regionalweak expression: see section 10 11 14
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 15 16
orbito-sphenoid
weak weak
regionalweak expression: see section 04 05 19 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36990
Entity Detected:Sars, seryl-aminoacyl-tRNA synthetase ( MGI:102809)
Sequence:sense strand is shown

>T36990
TAATGATGAGGACGCAGACAACAAAGTAGAACGTATTTGGGGAGATTGTACAGTCAGGAAGAAGTATTCC
CATGTGGACCTGGTGGTGATGGTAGATGGCTTTGAAGGCGAAAAGGGAGCCGTGGTGGCTGGTAGTCGGG
GGTACTTCCTGAAGGGGCCCCTGGTGTTCCTGGAGCAGGCGCTTATCCAATATGCACTGCGTACCTTGGG
GAGTCGGGGCTACACTCCAATCTACACCCCCTTCTTCATGAGGAAAGAGGTCATGCAGGAAGTGGCCCAG
CTCAGCCAGTTTGATGAAGAACTTTATAAGGTGATTGGCAAAGGCAGCGAAAAGTCAGATGACAACTCCT
ATGACGAGAAATACTTGATTGCCACCTCAGAGCAGCCCATCGCGGCTCTGCACCGGGACGAGTGGCTGCG
GCCAGAGGATCTGCCCATCAAGTACGCTGGCCTCTCCACCTGCTTTCGTCAGGAAGTGGGCTCGCATGGC
CGTGACACCCGTGGTATCTTCCGAGTCCATCAGTTTGAGAAGATTGAGCAGTTTGTGTACTCATCGCCCC
ATGACAATAAGTCGTGGGAGATGTTTGATGAGATGATCGCCACCGCAGAAGAATTCTACCAGTCTTTGGG
GATCCCTTACCACATTGTGAATATTGTCTCAGGCTCCTTGAATCACGCTGCCAGTAAGAAGCTCGACCTG
GAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89231. Forward Primer - name:089231_F_cDNA_Sars1, sequence:TAATGATGAGGACGCAGACAAC; Reverse Primer - name:089231_N_SP6_cDNA_Sars1, sequence:CCTCCAGGTCGAGCTTCTTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20078 same embryo
 EMAGE:20079 same embryo
 EMAGE:20080 same embryo
 EMAGE:20081 same embryo
 EMAGE:20082 same embryo
 EurExpress:euxassay_012234 same experiment
 MGI:4827871 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS