Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20121

Tnr tenascin R ( MGI:99516)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121
"Pseudo-wholemount" of euxassay_012507. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012507_01 euxassay_012507_02 euxassay_012507_03 euxassay_012507_04
EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121
euxassay_012507_05 euxassay_012507_06 euxassay_012507_07 euxassay_012507_08 euxassay_012507_09
EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121
euxassay_012507_10 euxassay_012507_11 euxassay_012507_12 euxassay_012507_13 euxassay_012507_14
EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121 EMAGE:20121
euxassay_012507_15 euxassay_012507_16 euxassay_012507_17 euxassay_012507_18 euxassay_012507_19
EMAGE:20121 EMAGE:20121
euxassay_012507_20 euxassay_012507_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20121Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20121_wholemount_strong.wlz
20121_wholemount_moderate.wlz
20121_wholemount_weak.wlz
20121_wholemount_possible.wlz
20121_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20121_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 08 09 10 11 12 13 14 15 16
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 08 09 10 18 19 20 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 01 02 03 04 05 06 08 09 10 11 12 13 14 15 17
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 10 11 12 15 17 18 19 20 21
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 07 08 09 10 11 12 13 14 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 03 05 06 11 12 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 05 06 07 08 09 10 11 12 13 14 15 17
tegmentum
moderate moderate
regionalmoderate expression: see section 08 12 weak expression: see section 09 10 11
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 15 weak expression: see section 08 09 10 11 12 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38063
Entity Detected:Tnr, tenascin R ( MGI:99516)
Sequence:sense strand is shown

>T38063
GTTGCGCCTTTTGATTACTACCGAGTATCGTACCGACCCACCCAAGTGGGACGGCTAGACAGCTCCGTAG
TGCCCAACACCGTGACAGAGTTCGCCATCACCAGGCTGTATCCAGCTACTGAATATGAAATAAGCCTCAA
CAGTGTACGGGGCAGGGAGGAGAGTGAACGCATCTGCACCCTGGTGCACACAGCCATGGATAGCCCCATG
GATTTGATCGCTACCAACATCACACCTACAGAAGCCTTGCTCCAGTGGAAAGCACCCATGGGTGAAGTGG
AAAATTATGTCATCGTCCTCACACACTTTGCAATTGCTGGAGAGACCATCCTGGTTGACGGGGTCAGCGA
AGAATTCCAGCTTGTAGACTTGCTTCCTAGCACCCACTACACTGTCACTATGTATGCCACCAGTGGGCCT
CTCATGAGTGGCACCATTGCCACCAACTTCTCCACCCTCCTGGACCCTCCTGACAACCTGACAGCCAGTG
AAGTCACCAGGCAAAGCGCACTGATCTCCTGGCAGCCGCCCAGAGCTGCGATTGAAAACTATGTCTTGAC
ATACAAGTCCACCGATGGAAGCCGCAAAGAGCTGATAGTGGATGCTGAGGACACCTGGATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64260. Forward Primer - name:064260_F_cDNA_Tnr, sequence:GTTGCGCCTTTTGATTACTACC; Reverse Primer - name:064260_N_SP6_cDNA_Tnr, sequence:GATCCAGGTGTCCTCAGCATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20118 same embryo
 EMAGE:20120 same embryo
 EMAGE:20119 same embryo
 EMAGE:20122 same embryo
 EurExpress:euxassay_012507 same experiment
 MGI:4828862 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS