Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20122

Uchl4 ubiquitin carboxyl-terminal esterase L4 ( MGI:1890440)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122
"Pseudo-wholemount" of euxassay_012464. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012464_01 euxassay_012464_02 euxassay_012464_03 euxassay_012464_04
EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122
euxassay_012464_05 euxassay_012464_06 euxassay_012464_07 euxassay_012464_08 euxassay_012464_09
EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122
euxassay_012464_10 euxassay_012464_11 euxassay_012464_12 euxassay_012464_13 euxassay_012464_14
EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122
euxassay_012464_15 euxassay_012464_16 euxassay_012464_17 euxassay_012464_18 euxassay_012464_19
EMAGE:20122 EMAGE:20122 EMAGE:20122 EMAGE:20122
euxassay_012464_20 euxassay_012464_21 euxassay_012464_22 euxassay_012464_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20122Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20122_wholemount_strong.wlz
20122_wholemount_moderate.wlz
20122_wholemount_weak.wlz
20122_wholemount_possible.wlz
20122_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20122_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 16 17 18 19
diencephalon
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
vibrissa
weak weak
regionalweak expression: see section 07 08 22 23
telencephalon
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 22 23
medulla oblongata
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 20
metencephalon
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
weak weak
regionalweak expression: see section 03 04 05 06 08 09 10 11 12 13 14 15
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21
spinal cord
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 15 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 23
naris
weak weak
regionalweak expression: see section 17
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 13 15 16 17 18 19
mandible
weak weak
regionalweak expression: see section 09 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 07 19
maxilla
weak weak
regionalweak expression: see section 09 18
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 17
upper jaw molar
weak weak
regionalweak expression: see section 07 19 20
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38078
Entity Detected:Uchl4, ubiquitin carboxyl-terminal esterase L4 ( MGI:1890440)
Sequence:sense strand is shown

>T38078
GTTTGTTGATGTGTACGGGATGGAGTCTGAACTTCTTAGCATCATACCAAGACCAGTGTGCGCAGTGTTA
CTCCTCTTCCCTATCACAGAAAAGTATGAAGTCTTCAGAACAGAAGAGGAAGAAAAGATAAAATCTCAAG
GACAAGATGTGACATCATCAGTATATTTTATGAAACAAACCATCAGCAATGCCTGTGGAACGATTGGAAC
GATTGGACTAATCCATGCCATTGCAAACAACAAAGACAAGGTGCACTTTGAATCAGGGTCAACATTGAAA
AAGTTCCTGGAGGAGTCTGTATCAATGAGCCCTGAAGAGAGAGCCAAATACCTGGAGAACTATGACGCTA
TTCGAGTTACTCATGAAACCAGTGCACATGAAGGTCAGACTGAGGCACCAAGTATAGATGAAAAAGTAGA
TCTTCATTTTATTGCGTTAGTACATGTAGATGGGCATCTCTATGAATTAGATGGATGGAAACCATTTCCA
ATTAACCATGGGAAAACTAGCGATGAGACGTTGTTAGAGGATGTCATAAAAGTTTGCAAGAAGTTCATGG
AACGTGACCCTGATGAGTTAAGATTTAATGCAATTGCTCTCTCGGCAGCATAGCATCTTGACAGAAACAC
CAAATACTGTATTATTTGCAACAAAAGTTAAATTTCTGATGCCATAACTAACTCAAAATTTTTAATATTT
TCATTAACTTGACTAATTAAACTTTATGTGGAAACAAACAAACAAACAAACAAGGCAAAAGAAACTGTTG
TAGAAGGAATGTTCTAGTACAAGAATAGCCCAGCAGTGGTGGTGTATACCTTTAATCCCAGTACTCAGGA
GACAGAGGCAGGTGGCTCTCCAAGTTCTAGACTAGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91974. Forward Primer - name:091974_F_cDNA_Uchl4, sequence:GTTTGTTGATGTGTACGGGATG; Reverse Primer - name:091974_N_SP6_cDNA_Uchl4, sequence:GGCTAGTCTAGAACTTGGAGAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20118 same embryo
 EMAGE:20120 same embryo
 EMAGE:20119 same embryo
 EMAGE:20121 same embryo
 EurExpress:euxassay_012464 same experiment
 MGI:4829070 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS