Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20141

Rrm1 ribonucleotide reductase M1 ( MGI:98180)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141
"Pseudo-wholemount" of euxassay_012459. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012459_01 euxassay_012459_02 euxassay_012459_03 euxassay_012459_04
EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141
euxassay_012459_05 euxassay_012459_06 euxassay_012459_07 euxassay_012459_08 euxassay_012459_09
EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141
euxassay_012459_10 euxassay_012459_11 euxassay_012459_12 euxassay_012459_13 euxassay_012459_14
EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141 EMAGE:20141
euxassay_012459_15 euxassay_012459_16 euxassay_012459_17 euxassay_012459_18 euxassay_012459_19
EMAGE:20141 EMAGE:20141 EMAGE:20141
euxassay_012459_20 euxassay_012459_21 euxassay_012459_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20141Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20141_wholemount_strong.wlz
20141_wholemount_moderate.wlz
20141_wholemount_weak.wlz
20141_wholemount_possible.wlz
20141_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20141_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
thymus primordium
strong strong
regionalstrong expression: see section 09 10 11 12 13
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 15 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 16 17 18 19 20
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 12 13 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 09 10 15 16 17 18 19 20 weak expression: see section 06 07 08 11 13
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 09 10 15 16 17 18 19 20 weak expression: see section 06 07 08 11 13 14
pons ventricular layer
weak weak
regionalweak expression: see section 09 10 11 13 14
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 20 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
mandible
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 08 09 13 moderate expression: see section 12
lower jaw molar
strong strong
regionalstrong expression: see section 05 17
upper jaw incisor
strong strong
regionalstrong expression: see section 08 09 13 moderate expression: see section 12
upper jaw molar
strong strong
regionalstrong expression: see section 05 17
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 11 12
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 14 15 16 17
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
tail mesenchyme
weak weak
regionalweak expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31328
Entity Detected:Rrm1, ribonucleotide reductase M1 ( MGI:98180)
Sequence:sense strand is shown

>T31328
TGTATTCGGGCCACTGGTAGCTACATCGCTGGGACTAATGGCAATTCTAATGGCCTTGTGCCAATGCTGA
GAGTATATAACAACACAGCTCGCTATGTGGATCAAGGTGGAAACAAGCGCCCAGGCGCGTTTGCTATTTA
CCTGGAGCCTTGGCACTTAGACATCTTTGAGTTCCTTGACTTGAAGAAGAACACAGGCAAGGAAGAACAG
CGAGCACGCGATCTCTTCTTTGCACTTTGGATCCCAGATCTCTTCATGAAGCGAGTGGAGACTAACCAGG
ACTGGTCATTGATGTGTCCCAATGAGTGTCCTGGTCTGGACGAGGTCTGGGGAGAGGAGTTTGAGAAGTT
ATATGAAAGTTACGAGAAGCAGGGTCGTGTCCGAAAAGTTGTAAAAGCTCAGCAGCTTTGGTATGCCATC
ATTGAGTCCCAGACGGAGACCGGTACCCCATACATGCTCTACAAAGATTCCTGTAACCGGAAGAGCAACC
AGCAGAACCTGGGAACCATCAAATGCAGCAACCTGTGTACAGAAATAGTAGAGTACACCAGTAAAGATGA
GGTTGCAGTTTGTAACTTGGCTTCTCTGGCTCTGAATATGTATGTCACACCGGAACATACGTATGACTTT
GAGAAACTGGCAGAAGTCACTAAAGTCATTGTCCGAAATCTGAATAAAATAATTGATATAAACTACTACC
CTATTCCAGAGGCACACTTATCAAATAAACGCCATCGGCCCATTGGAATTGGGGTACAAGGTTTAGCAGA
TGCTTTCATCCTGATGAGATACCCCTTTGAGAGCCCAGAAGCCCAGTTATTAAATAAGCAGATCTTTGAA
ACCATTTACTATGGAGCCCTGGAAGCCAGCTGTGAACTAGCCAAGGAGTATGGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4485739), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 36935. Forward Primer - name:036935_F_IRAV51-54_I07_Rrm1, sequence:TGTATTCGGGCCACTGGT; Reverse Primer - name:036935_R_SP6_IRAV51-54_I07_Rrm1, sequence:GGGCCATACTCCTTGGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20139 same embryo
 EMAGE:20140 same embryo
 EMAGE:20142 same embryo
 EurExpress:euxassay_012459 same experiment
 MGI:4827816 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS