Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20219

Pax3 paired box gene 3 ( MGI:97487)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219
"Pseudo-wholemount" of euxassay_012277. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012277_01 euxassay_012277_02 euxassay_012277_03 euxassay_012277_04
EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219
euxassay_012277_05 euxassay_012277_06 euxassay_012277_07 euxassay_012277_08 euxassay_012277_09
EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219
euxassay_012277_10 euxassay_012277_11 euxassay_012277_12 euxassay_012277_13 euxassay_012277_14
EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219 EMAGE:20219
euxassay_012277_15 euxassay_012277_16 euxassay_012277_17 euxassay_012277_18 euxassay_012277_19
EMAGE:20219
euxassay_012277_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20219Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20219_wholemount_strong.wlz
20219_wholemount_moderate.wlz
20219_wholemount_weak.wlz
20219_wholemount_possible.wlz
20219_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20219_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 01 02 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 12 13
diencephalon roof plate
strong strong
regionalstrong expression: see section 11
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 05 weak expression: see section 04
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 07 08 11 15 16 17 moderate expression: see section 06 09 10 12 13 14 18
pons ventricular layer
strong strong
regionalstrong expression: see section 07 15 16 moderate expression: see section 06 14
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 weak expression: see section 12
nose
moderate moderate
regionalmoderate expression: see section 06 07 11 weak expression: see section 04
naris
moderate moderate
regionalmoderate expression: see section 09 10
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
lower lip
moderate moderate
regionalmoderate expression: see section 04 05 06 07 10 11 12 13 weak expression: see section 09 14
upper lip
moderate moderate
regionalmoderate expression: see section 03 04 05 10 11 12 13 weak expression: see section 09 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30426
Entity Detected:Pax3, paired box gene 3 ( MGI:97487)
Sequence:sense strand is shown

>T30426
CAACCATCTCATTCCGGGGGGATTCCCTCCCACCGCCATGCCGACCCTGCCAACATACCAGCTGTCGGAG
ACCTCTTACCAGCCCACGTCTATTCCACAAGCCGTGTCAGATCCCAGTAGCACCGTCCACAGACCTCAGC
CGCTTCCTCCGAGCACTGTACACCAAAGCACTATTCCTTCGAACGCAGACAGCAGCTCTGCCTACTGCCT
CCCCAGCACCAGGCATGGATTTTCAAGCTATACAGACAGCTTTGTGCCTCCATCGGGGCCCTCCAACCCC
ATGAACCCCACCATCGGCAATGGCCTTTCACCTCAGGTAATGGGACTTCTGACCAACCACGGTGGGGTAC
CGCACCAGCCTCAGACCGACTATGCTCTCTCCCCTCTCACTGGGGGCCTGGAACCCACGACCACGGTGTC
AGCCAGCTGCAGTCAGAGACTGGAACATATGAAGAATGTGGACAGTCTGCCCACATCTCAGCCCTATTGT
CCCCCCACCTATAGCACCGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6518115), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58562. Forward Primer - name:058562_F_IRAV105_a04_Pax3, sequence:CAACCATCTCATTCCGGG; Reverse Primer - name:058562_R_SP6_IRAV105_a04_Pax3, sequence:TGCGGTGCTATAGGTGGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20220 same embryo
 EMAGE:20218 same embryo
 EurExpress:euxassay_012277 same experiment
 MGI:4827063 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS