Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20239

Exosc7 exosome component 7 ( MGI:1913696)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239
"Pseudo-wholemount" of euxassay_012334. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012334_01 euxassay_012334_02 euxassay_012334_03 euxassay_012334_04
EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239
euxassay_012334_05 euxassay_012334_06 euxassay_012334_07 euxassay_012334_08 euxassay_012334_09
EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239
euxassay_012334_10 euxassay_012334_11 euxassay_012334_12 euxassay_012334_13 euxassay_012334_14
EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239 EMAGE:20239
euxassay_012334_15 euxassay_012334_16 euxassay_012334_17 euxassay_012334_18 euxassay_012334_19
EMAGE:20239 EMAGE:20239 EMAGE:20239
euxassay_012334_20 euxassay_012334_21 euxassay_012334_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20239Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20239_wholemount_strong.wlz
20239_wholemount_moderate.wlz
20239_wholemount_weak.wlz
20239_wholemount_possible.wlz
20239_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20239_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 11 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 14 15 16 17
pancreas
strong strong
regionalstrong expression: see section 07 08 09 10
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 02
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 08 09 12
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 16
upper jaw incisor
strong strong
regionalstrong expression: see section 08 09
upper jaw molar
strong strong
regionalstrong expression: see section 05 06 16
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
renal cortex
strong strong
regionalstrong expression: see section 07 08 14 15 16 17
renal medullary interstitium
strong strong
regionalstrong expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30478
Entity Detected:Exosc7, exosome component 7 ( MGI:1913696)
Sequence:sense strand is shown

>T30478
CTAAGCGAGGCCGAGAAGGTCTACATCGTTCATGGAGTGCAGGAAGACCTTCGGGTGGATGGCCGTGGCT
GTGAGGACTACCGATGTGTTGAAGTAGAGACTGATGTGGTGTCTAACACCAGTGGGTCTGCCAGAGTCAA
GCTGGGTCACACAGACATCTTGGTGGGAGTGAAAGCAGAAATGGGGACACCGAAGCTGGAGAAACCGAAT
GAAGGCTACCTGGAGTTCTTTGTTGACTGTTCAGCCAATGCTACCCCAGAATTCGAAGGGCGAGGAGGTG
ATGACCTTGGCACAGAGATTGCTAACACCCTCTACCGGATATTTAACAACAAGAGCAGCGTAGACCTGAG
GTCCCTCTGCATCAGTCCTCGAGAGCACTGCTGGGTTCTATATGTGGATGTGCTGCTGCTGGAATGTGGT
GGGAATTTGTTTGATGCTATTTCCATTGCTGTAAAAGCTGCTCTCTTCGACACAAGGATACCAAGGGTTC
GTGTTCTGGAGGATGAAGAGGGGGCAAAGGACATTGAGCTGTCTGACGATCCTTATGACTGCATCCGACT
GAGTGTAGAGAATGTCCCCTGCATTGTCACCCTGTGCAAGATTGGCTGCCGGCATGTGGTAGATGCCACA
CTCCAAGAGGAGGCCTGTTCCCTGGCCAGCTTGCTGGTGTCAGTGACCAGCAAGGGAGTAGTGACATGCA
TGAGGAAAGTGGGGAAAGGAAGCCTGGATCCTGAGAGCATCTTCGAGATGATGGAGAGCAGCAAGCGAGT
GGGCAAGGTGCTGCACGTGTCCTTGCAGAGCCTTCTGCACAAGGAAGAAAGCCTGGGGCCCAAGAGGCCG
AGAGTCGGGTTCCTGGGGTGATTTCTCTCCACTGCACGTTGGTTGCCTCACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30041585), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58689. Forward Primer - name:058689_F_IRAV107_e09_Exosc7, sequence:CTAAGCGAGGCCGAGAAG; Reverse Primer - name:058689_R_SP6_IRAV107_e09_Exosc7, sequence:AAGTGAGGCAACCAACGTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20237 same embryo
 EMAGE:20236 same embryo
 EMAGE:20240 same embryo
 EMAGE:20235 same embryo
 EMAGE:20238 same embryo
 EurExpress:euxassay_012334 same experiment
 MGI:4824650 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS