Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20241

5133401N09Rik RIKEN cDNA 5133401N09 gene ( MGI:1922981)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241
"Pseudo-wholemount" of euxassay_012364. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012364_01 euxassay_012364_02 euxassay_012364_03 euxassay_012364_04
EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241
euxassay_012364_05 euxassay_012364_06 euxassay_012364_07 euxassay_012364_08 euxassay_012364_09
EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241
euxassay_012364_10 euxassay_012364_11 euxassay_012364_12 euxassay_012364_13 euxassay_012364_14
EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241 EMAGE:20241
euxassay_012364_15 euxassay_012364_16 euxassay_012364_17 euxassay_012364_18 euxassay_012364_19
EMAGE:20241 EMAGE:20241 EMAGE:20241
euxassay_012364_20 euxassay_012364_21 euxassay_012364_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20241Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20241_wholemount_strong.wlz
20241_wholemount_moderate.wlz
20241_wholemount_weak.wlz
20241_wholemount_possible.wlz
20241_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20241_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10 11 13 14
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 07
spinal cord
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31249
Entity Detected:5133401N09Rik, RIKEN cDNA 5133401N09 gene ( MGI:1922981)
Sequence:sense strand is shown

>T31249
GGCTCCGGAAAATCCACTGTGGGTGCGCTGCTGGCCTCCAAGCTGGGATGGAAATTCTATGATGCCGATG
ATTACCACTCCGAGGAGAATCGGATAAAGATGGCGAAAGGGGTACCACTGAGCGACCAGGACAGGATTCC
ATGGCTTTGCACCTTGCACGACATTTTACTAAGAGATGTGGCTTTGGGACAGCCTGTTGTTCTAGCCTGT
TCAGCTCTGAAGAAAACGTACAGAGACATCTTGATCCGAGGAGGAAGTGATGCGCCCCTGAAAAGTGATG
ACTCAGCAAAGGAACCGCTGGCTGGTGGGAAGCTCCTGGTGGTCTACCTCTGCGGCTCGTTTGACATCAT
TTATGGACGCTTGCTCCAAAGAAAAGGACATTTTATGCCGCCCGAGTTACTGCAGTCCCAGTTTAGTATT
CTGGAGCCCCCATCAGCTCCCGAAAACTTCATCCAAGTCAGCGTGGACAAAAGTCTCCCGGAGATCACCG
CTGCCGTTATGGAAGCCCTCAAGTGAAGAACTCGTTCATAGCAGAGTACACTCTGCTCCCAAGCTCCTCG
CCCGTGGTGTCTTCTGAATTCTTTATTTTTAGAGGCAGTGTTTCTCTGTTGACCAGGGTGGTCTGGAATG
CAGAGATCTGCCTGCCTCTGCCACCCCGAGGGCAGGGATTAAAGGCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4192995), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55519. Forward Primer - name:055519_F_IRAV49_c10_5133401N09Rik, sequence:GGCTCCGGAAAATCCACT; Reverse Primer - name:055519_R_SP6_IRAV49_c10_5133401N09Rik, sequence:ACGCCTTTAATCCCTGCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20244 same embryo
 EMAGE:20243 same embryo
 EMAGE:20242 same embryo
 EMAGE:20245 same embryo
 EurExpress:euxassay_012364 same experiment
 MGI:4822757 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS