Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20273

Esrp2 epithelial splicing regulatory protein 2 ( MGI:1924661)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273
"Pseudo-wholemount" of euxassay_012389. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012389_01 euxassay_012389_02 euxassay_012389_03 euxassay_012389_04
EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273
euxassay_012389_05 euxassay_012389_06 euxassay_012389_07 euxassay_012389_08 euxassay_012389_09
EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273
euxassay_012389_10 euxassay_012389_11 euxassay_012389_12 euxassay_012389_13 euxassay_012389_14
EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273
euxassay_012389_15 euxassay_012389_16 euxassay_012389_17 euxassay_012389_18 euxassay_012389_19
EMAGE:20273 EMAGE:20273 EMAGE:20273 EMAGE:20273
euxassay_012389_20 euxassay_012389_21 euxassay_012389_22 euxassay_012389_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20273Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20273_wholemount_strong.wlz
20273_wholemount_moderate.wlz
20273_wholemount_weak.wlz
20273_wholemount_possible.wlz
20273_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20273_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 15
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 11 15 16
pituitary gland
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 19 20 21 22
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 20 21 22 23 moderate expression: see section 16 17 18 19
cornea epithelium
strong strong
regionalstrong expression: see section 03 04 22 23
anterior naris epithelium
strong strong
regionalstrong expression: see section 11 12 15 16
external naris epithelium
strong strong
regionalstrong expression: see section 11 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 moderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 12 13
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 14
tongue epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 moderate expression: see section 10
rectum
strong strong
regionalstrong expression: see section 14
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 15
lower jaw molar
strong strong
regionalstrong expression: see section 07 18
oral epithelium
strong strong
regionalstrong expression: see section 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 15
upper jaw molar
strong strong
regionalstrong expression: see section 07
bladder
strong strong
regionalstrong expression: see section 13 14
kidney calyx
moderate moderate
regionalmoderate expression: see section 08 09 10 17 18
ureter
moderate moderate
regionalmoderate expression: see section 11 15 16
urethra of male
strong strong
regionalstrong expression: see section 14
larynx
moderate moderate
regionalmoderate expression: see section 12 13
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23
trachea epithelium
moderate moderate
regionalmoderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31267
Entity Detected:Esrp2, epithelial splicing regulatory protein 2 ( MGI:1924661)
Sequence:sense strand is shown

>T31267
GTTGCCCTGGCAATCATCAGACCAGGATGTGGCTCGATTCTTCAAAGGGCTCAACATTGCCAGGGGTGGT
GTGGCCCTCTGTCTCAACGCCCAGGGCCGCAGAAATGGCGAGGCCCTCATCCGATTCGTGGACAGCGAGC
AGCGGGACCTAGCGCTGCAGAGACACAAACACCACATGGGTGTCCGCTATATTGAGGTATATAAAGCCAC
AGGGGAGGAATTCGTAAAGATTGCAGGGGGCACATCACTAGAGGTGGCCCGTTTCCTATCACGGGAAGAT
CAAGTGATCCTGAGGCTACGGGGACTACCCTTTTCAGCCGGGCCAACAGATGTTCTAGGCTTCCTGGGGC
CAGAATGCCCAGTGACTGGGGGTGCTGATGGGCTGCTCTTTGTCCGCCACCCTGATGGCAGGCCTACTGG
GGATGCCTTTGCTCTCTTTGCCTGTGAGGAGCTGGCACAGGCTGCTCTGCGCAGGCACAAAGGCATGCTG
GGTAAGCGATACATTGAACTCTTCAGGAGCACGGCAGCCGAGGTGCAGCAGGTCCTTAACCGCTATGCAG
CCAGTCCACTCCTTCCCACACTGACTGCTCCACTGCTGCCCATTCCCTTTCCACTGGCAGGAGGAACTGG
GAGGGACTGTGTTCGCCTTAGAGGCCTGCCCTACACAGCCACCATTGAAGACATTCTGAGTTTTCTAGGA
GAGGCAGCAGCTGACATTCGGCCTCATGGTGTGCATATGGTGCTCAACCAACAGGGCCGGCCATCCGGTG
ACGCCTTCATCCAGATGATGTCGGTGGAGCGTGCTCTGGCTGCTGCCCAGCGATGCCACAAGAAGATGAT
GAAAGAACGCTATGTGGAAGTAGTCCCTTGTTCCACAGAGGAGATGAGCCGTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4222237), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55775. Forward Primer - name:055775_F_IRAV49_f10_9530027K23Rik, sequence:GTTGCCCTGGCAATCATC; Reverse Primer - name:055775_R_SP6_IRAV49_f10_9530027K23Rik, sequence:GCACACGGCTCATCTCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20272 same embryo
 EMAGE:20270 same embryo
 EMAGE:20275 same embryo
 EMAGE:20271 same embryo
 EMAGE:20274 same embryo
 EurExpress:euxassay_012389 same experiment
 MGI:4824625 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS