Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20314

Clip2 CAP-GLY domain containing linker protein 2 ( MGI:1313136)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314
"Pseudo-wholemount" of euxassay_012448. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012448_01 euxassay_012448_02 euxassay_012448_03 euxassay_012448_04
EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314
euxassay_012448_05 euxassay_012448_06 euxassay_012448_07 euxassay_012448_08 euxassay_012448_09
EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314
euxassay_012448_10 euxassay_012448_11 euxassay_012448_12 euxassay_012448_13 euxassay_012448_14
EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314
euxassay_012448_15 euxassay_012448_16 euxassay_012448_17 euxassay_012448_18 euxassay_012448_19
EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314 EMAGE:20314
euxassay_012448_20 euxassay_012448_21 euxassay_012448_22 euxassay_012448_23 euxassay_012448_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20314Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20314_wholemount_strong.wlz
20314_wholemount_moderate.wlz
20314_wholemount_weak.wlz
20314_wholemount_possible.wlz
20314_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20314_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon marginal layer
moderate moderate
homogeneousmoderate expression: see section 06
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 20 21 moderate expression: see section 05 06 07
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 20 21 22 moderate expression: see section 05 06 07 08 09 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 17
not examined not examined
homogeneousnot examined expression: see section 06 07
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
spinal cord marginal layer
moderate moderate
regionalmoderate expression: see section 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
neural retina
strong strong
regionalstrong expression: see section 03 04 23 24 moderate expression: see section 01 02
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31343
Entity Detected:Clip2, CAP-GLY domain containing linker protein 2 ( MGI:1313136)
Sequence:sense strand is shown

>T31343
TGGGGCTCATGGACAACTGGAAATCCAAGCTGGACTCGCTGGCCTCCGATCACCAGAAATCCCTGGAGGA
CCTGAAGGCCACGCTGAACTCTGGCCCAGGCGCCCAGCAGAAGGAGATCGGAGAGTTGAAGGCCCTGGTA
GAGGGCATCAAGATGGAGCACCAGCTGGAGTTAGGTAACCTGCAGGCCAAGCACGACTTGGAGACGGCCA
TGCATGGGAAGGAGAAGGAGGGCCTGCGGCAGAAGCTGCAAGAGGTCCAGGAGGAGCTGGCCGGGCTGCA
GCAGCACTGGAGGGAGCAGCTGGAGGAGCAGGCCAGCCAGCATCGGCTGGAGCTCCAAGAAGCCCAGGAC
CAATGTCGCGACGCCCAGCTGCGCGCGCAGGAGCTAGAGGGACTGGATGTGGAGTACCGTGGCCAGGCTC
AGGCCATCGAGTTCCTCAAAGAGCAGATCTCACTGGCTGAAAAGAAGATGCTAGATTACGAGATGCTGCA
GAGGGCCGAAGCCCAGAGCAGGCAGGAGGCCGAGCGGCTGCGGGAAAAGCTTCTGGTGGCTGAGAATAGA
CTCCAGGCTGCCGAGTCCCTGTGCTCAGCCCAGCACAGCCATGTGATCGAATCCAGTGACCTTTCTGAGG
AGACAATTCGGATGAAGGAGACTGTAGAGGGCCTGCAGGACAAGCTGAACAAGAGGGACAAAGAGGTGAC
AGCCTTGACATCCCAGATGGACATGCTCAGGGCCCAAGTAAGTGCTCTAGAAAACAAGTGCAAATCAGGA
GAGAAGAAGATAGATTCTCTCCTGAAGGAGAAGAGGCGCCTAGAGGCAGAGCTGGAGGCTGTGTCTCGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3498067), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 21375. Forward Primer - name:021375_F_IRAV51-54_L23_Cyln2, sequence:TGGGGCTCATGGACAACT; Reverse Primer - name:021375_R_SP6_IRAV51-54_L23_Cyln2, sequence:TTCCGAGACACAGCCTCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20318 same embryo
 EMAGE:20315 same embryo
 EMAGE:20316 same embryo
 EMAGE:20313 same embryo
 EMAGE:20317 same embryo
 EurExpress:euxassay_012448 same experiment
 MGI:4823928 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS