Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20318

Lss lanosterol synthase ( MGI:1336155)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318
"Pseudo-wholemount" of euxassay_012456. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012456_01 euxassay_012456_02 euxassay_012456_03 euxassay_012456_04
EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318
euxassay_012456_05 euxassay_012456_06 euxassay_012456_07 euxassay_012456_08 euxassay_012456_09
EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318
euxassay_012456_10 euxassay_012456_11 euxassay_012456_12 euxassay_012456_13 euxassay_012456_14
EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318
euxassay_012456_15 euxassay_012456_16 euxassay_012456_17 euxassay_012456_18 euxassay_012456_19
EMAGE:20318 EMAGE:20318 EMAGE:20318 EMAGE:20318
euxassay_012456_20 euxassay_012456_21 euxassay_012456_22 euxassay_012456_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20318Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20318_wholemount_strong.wlz
20318_wholemount_moderate.wlz
20318_wholemount_weak.wlz
20318_wholemount_possible.wlz
20318_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20318_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 14 15
vibrissa
weak weak
regionalweak expression: see section 06 07 20 21
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 weak expression: see section 09
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 09 10 13 14 15
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 09 15
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 weak expression: see section 06 07 08 15
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
trigeminal v nerve
weak weak
regionalweak expression: see section 09 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 17 weak expression: see section 11
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 17 weak expression: see section 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13 14 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23
mandible
weak weak
regionalweak expression: see section 03 04 05 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15
lower jaw molar
weak weak
regionalweak expression: see section 08 18
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 15
upper jaw molar
weak weak
regionalweak expression: see section 08 18
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 19 20 21 22 weak expression: see section 16 18 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31342
Entity Detected:Lss, lanosterol synthase ( MGI:1336155)
Sequence:sense strand is shown

>T31342
GTCAGGCATCCCGACATCACTGCTCAGGAGAGAGGGATCAGATGTCTGCTAGGGAAGCAGTTACCCAATG
GAGACTGGCCTCAGGAGAACATCTCTGGGGTCTTCAACAAGTCCTGTGCCATCAGCTACACAAGTTACAG
AAACATCTTCCCCATCTGGGCCCTGGGCCGCTTCTCCAACCTGTATCCTGACAATACCCTCGCCGGCCAC
ATTTGAACACGTGTGTGTCTGCTGCACCTGGCCAGCATCATCACCATCCAGGTCCTGGAGAGCCCCGTGT
CTTGGCTGGGTGATAAGAGCCTTCTTAGCCCTGCTTAGGCCTCGTTCTCTATTTCTGTAGACAGGAGGCT
GGGGATAGGGTCAGTGTTGGTGTCTTTAGACACTTGTCAGTGTGCGCTTAAAGTTCTTGGACTAGCTTCA
GTGAGAAAGGGAAGAAGATGAGCCTTGAGATCCAGAGAGGCGCAGTGGATGGACTCGGAAGCTCCTGGGT
ATTCGTTCTCCCCGAGGGAGAGAGGCTATAGAGCTTCTGTGATCAATGACTTCCCTGTGAGGGAGCAGCT
GGCTTCTTCACTGCTTCCCTTGTTGATTGTGGAGTGGGCACTTGAGCATCTTGTGTTTGCTGTGCTGAGG
GAGTTAGAGCAGCCATATGGTGCAGGGGTGCTCAGAGAAAGGCTCAATGGCAGGTGAGGCAGGTCCCTTA
CTCATTGTGCCCTGAGCAGTGTCTGGTGTCCCTAGAAACTTGCTACCCATGACTACATCACTATATGAAA
TGCCAGTTATTCAGAAAGGAAATACAAACTGGCTTTGTACCAGAAATGCTACTAAAAGTCATTTGAATGA
TCACCGACTCCCTTACTAAACAGACCCTGGGCGTAGTAAAGAACAGCGGCTGCTCTCTCAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3498101), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 21380. Forward Primer - name:021380_F_IRAV51-54_L21_Lss, sequence:GTCAGGCATCCCGACATC; Reverse Primer - name:021380_R_SP6_IRAV51-54_L21_Lss, sequence:CCTCTGAGAGAGCAGCCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20314 same embryo
 EMAGE:20315 same embryo
 EMAGE:20316 same embryo
 EMAGE:20313 same embryo
 EMAGE:20317 same embryo
 EurExpress:euxassay_012456 same experiment
 MGI:4826017 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS