Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20348

Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 ( MGI:2139365)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348
"Pseudo-wholemount" of euxassay_009127. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009127_01 euxassay_009127_02 euxassay_009127_03 euxassay_009127_04
EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348
euxassay_009127_05 euxassay_009127_06 euxassay_009127_07 euxassay_009127_08 euxassay_009127_09
EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348
euxassay_009127_10 euxassay_009127_11 euxassay_009127_12 euxassay_009127_13 euxassay_009127_14
EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348
euxassay_009127_15 euxassay_009127_16 euxassay_009127_17 euxassay_009127_18 euxassay_009127_19
EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348 EMAGE:20348
euxassay_009127_20 euxassay_009127_21 euxassay_009127_22 euxassay_009127_23 euxassay_009127_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20348Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20348_wholemount_strong.wlz
20348_wholemount_moderate.wlz
20348_wholemount_weak.wlz
20348_wholemount_possible.wlz
20348_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20348_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20
forearm mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03
upper arm mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 24
hand
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 23 24
foot
moderate moderate
regionalmoderate expression: see section 08 09 20 21 22 23 24
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 06 07
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 06 07
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 06 07
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 06 07
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 06 07
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 23 24
fibula
moderate moderate
regionalmoderate expression: see section 01
tibia
moderate moderate
regionalmoderate expression: see section 01 02
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 03 07 23
femur
moderate moderate
regionalmoderate expression: see section 01 02 08 09 20
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
adrenal medulla
moderate moderate
regionalmoderate expression: see section 09 10 11 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 16 17 18 19 20 weak expression: see section 12
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 15 16 17 18 19 20 21 22 23 24 weak expression: see section 12
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 12 13
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
pons mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 14 17 18 19
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 10 13 14 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 15 16 17 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 16 17
otic capsule
moderate moderate
regionalmoderate expression: see section 08 09 10 17 18 19 20
naris
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
viscerocranium
strong strong
regionalExpression in the turbinate bone.
seminiferous cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 19 20 21
arytenoid cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14 15
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
trachea cartilaginous ring
moderate moderate
regionalmoderate expression: see section 13
axial skeleton
moderate moderate
regionalmoderate expression: see section 13 14 15 17
sternum
moderate moderate
regionalmoderate expression: see section 13 14
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2493
Entity Detected:Abtb2, ankyrin repeat and BTB (POZ) domain containing 2 ( MGI:2139365)
Sequence:sense strand is shown

>T2493
TCGAGGCCAGATTCGGCACGAGGCTAGTCGCCTGCCCCACGAGACTACTATGTTAGGAGTCTGAGCTCAG
AGCTTCCGAGCTGATGATGGGCTACAGTACAGGAACTCAAGGACTTCCGCTCTTGCTGCTACAACTGGCA
GCCAAAGTGAAGAGGTTGGTTCTAGGTCGGGCCTAGCTCTAATGTGTCTGCAGGCTGAGGCAGCAGAGTG
CCTTCCAGTTAGGACAGGGGTGCAAGAGCACACTTGTCACCTGGGATCTGTGACTCTGGGGCATGAAGGA
CAAGGCCTCGGTGGAAGAGAAGCTATGTCCCCTCCCATCCTGTCCTCAGTCTTGGCTCCCCATCCTCTGG
CCTGTTTGTGGACAGATGCTGGGACAGCATCAAGAACAGCTACCTTAGAAACTATTTATTCATCAGAAGC
CCCCAGGGCTTGCAATCCTGGAAAGATATTTTCAACTTGCTGCTTGTGCGGGATGTACAAAGGAATGAAT
GGTATTTTATTGCTGTAATATTGTATAATACTGTAACTATACCTTAATGTTGTTACTTA
Notes:The probe template was PCR amplified from IMAGE:1264304 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1264304 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20346 same embryo
 EMAGE:20347 same embryo
 EMAGE:20345 same embryo
 EurExpress:euxassay_009127 same experiment
 MGI:4822892 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS