Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20386

Dusp14 dual specificity phosphatase 14 ( MGI:1927168)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386
"Pseudo-wholemount" of euxassay_012633. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012633_01 euxassay_012633_02 euxassay_012633_03 euxassay_012633_04
EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386
euxassay_012633_05 euxassay_012633_06 euxassay_012633_07 euxassay_012633_08 euxassay_012633_09
EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386
euxassay_012633_10 euxassay_012633_11 euxassay_012633_12 euxassay_012633_13 euxassay_012633_14
EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386 EMAGE:20386
euxassay_012633_15 euxassay_012633_16 euxassay_012633_17 euxassay_012633_18 euxassay_012633_19
EMAGE:20386 EMAGE:20386
euxassay_012633_20 euxassay_012633_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20386Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20386_wholemount_strong.wlz
20386_wholemount_moderate.wlz
20386_wholemount_weak.wlz
20386_wholemount_possible.wlz
20386_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20386_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 15 16 17
diencephalon floor plate
weak weak
regionalweak expression: see section 11
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 weak expression: see section 01 02 21
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 05 06 07 08 09 12 14 15 16 17 18
medulla oblongata floor plate
weak weak
regionalweak expression: see section 11
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 14 15
metencephalon floor plate
weak weak
regionalweak expression: see section 11
pons mantle layer
weak weak
regionalweak expression: see section 16
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18
midbrain floor plate
weak weak
regionalweak expression: see section 11
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 15
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 12 13 14
metanephros
weak weak
regionalweak expression: see section 05 06 07 14 15 16
urethra of male
weak weak
regionalweak expression: see section 08 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31628
Entity Detected:Dusp14, dual specificity phosphatase 14 ( MGI:1927168)
Sequence:sense strand is shown

>T31628
TCATCAATGCCACCATCGAGATCCCCAACTTCAACTGGCCCCAGTTTGAATATGTTAAAGTGCCTCTGGC
TGACATTCCTCATGCCCCCATTAGACTGTACTTTGACACTGTGGCCGACAAGATCCACAGTGTGAGCAAG
AAGCACGGGGCTACCTTGGTGCACTGTGCGGCAGGCGTGAGCCGCTCGGCCACCCTCTGTATTGCGTACC
TGATGAAATTCCACAATCTGTGCCTGTTGGAGGCATACAACTGGGTGAAAGCCCGGAGGCCTGTCATCAG
GCCCAACCTGGGCTTCTGGAGGCAGCTGATAGACTACGAGAGCCAGCTCTTTGGGAAGTCTTCAGTTAAG
ATGGTACAGACACCCTATGGCATCATCCCAGACGTTTATGAGAAGGAGTCCCGACACTTGATGCCTTATT
GGGGGATTTAGTGTTGCCACAGCTGGCATCCACAGCCCCTCAGCAGTACCAGCATCTGCCACACACCATC
TGTTCCCCTCTTCCTCTCTCTCTGGTTCTCCCGAGAGGGTTTCTACGCTGGGTGTTCGGGTTTAAGAGAT
GGGGAGGGGAAATACGTGCGTTGCCTGTGACGTTTTTTAAAACTAGCATTTTGAAATAGTGAACATGGAA
ATCTTTAACTGGCCTTTAATCATTTGTAACAGCTGGACCAGTGTAGGACACCTTTCCTGCTTTCTTTCTG
GCTCCTGACTTTTAAGAGCCTTAGCAGGTGCAGTAGGAGCTCATTGCTCAGTTCTGGTCCTGATTAACCC
TCTAGAGACCAGCTTTGCCAAGGGCTGCAGGCTGGTCGGTTTAAGGAAGATCAAGGGCAGCTCAGTCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3592420), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 12954. Forward Primer - name:012954_F_IRAV08-11_C10_Dusp14, sequence:TCATCAATGCCACCATCG; Reverse Primer - name:012954_R_SP6_IRAV08-11_C10_Dusp14, sequence:AGGGACTGAGCTGCCCTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20384 same embryo
 EMAGE:20383 same embryo
 EMAGE:20387 same embryo
 EMAGE:20382 same embryo
 EMAGE:20385 same embryo
 EurExpress:euxassay_012633 same experiment
 MGI:4824413 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS