Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20394

Tfpi tissue factor pathway inhibitor ( MGI:1095418)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394
"Pseudo-wholemount" of euxassay_012616. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012616_01 euxassay_012616_02 euxassay_012616_03 euxassay_012616_04
EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394
euxassay_012616_05 euxassay_012616_06 euxassay_012616_07 euxassay_012616_08 euxassay_012616_09
EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394
euxassay_012616_10 euxassay_012616_11 euxassay_012616_12 euxassay_012616_13 euxassay_012616_14
EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394 EMAGE:20394
euxassay_012616_15 euxassay_012616_16 euxassay_012616_17 euxassay_012616_18 euxassay_012616_19
EMAGE:20394 EMAGE:20394
euxassay_012616_20 euxassay_012616_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20394Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20394_wholemount_strong.wlz
20394_wholemount_moderate.wlz
20394_wholemount_weak.wlz
20394_wholemount_possible.wlz
20394_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20394_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 not examined expression: see section 20 21
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
hindbrain meninges
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord meninges
weak weak
regionalweak expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31585
Entity Detected:Tfpi, tissue factor pathway inhibitor ( MGI:1095418)
Sequence:sense strand is shown

>T31585
GGGACCTGTCTCCGGATTTCTTCTGAAGACGGTATAATTTTGGGACCTCATCTCCAGATCTCATTTAAGG
ACTACTGACTCATCAAGAAATGACTTACAAAATGAAGAAAGAACATGCCTTTTGGGCCACTGTGTGTCTG
TTGCTTAGCCTTGTTCCCGAGTTTCTTAATGCTCTGTCTGAGGAAGCTGATGACACAGATTCTGAGCTGG
GGTCAATGAAACCGCTACATACATTTTGTGCAATGAAGGCAGATGATGGTCCATGCAAAGCAATGATAAG
GAGTTATTTTTTCAATATGTATACTCATCAATGTGAAGAATTTATATACGGGGGATGTGAAGGGAACGAG
AACCGATTTGATACCCTGGAAGAGTGTAAGAAAACATGCATACCAGGTTATGAGAAGACAGCTGTGAAGG
CAGCATCTGGAGCAGAAAGGCCAGATTTCTGCTTCTTGGAAGAGGACCCGGGACTCTGCCGAGGTTACAT
GAAGAGGTATCTTTATAACAACCAGACAAAGCAGTGTGAACGATTCGTGTACGGTGGCTGCCTGGGCAAC
CGCAACAACTTTGAAACTTTGGATGAGTGCAAGAAGATCTGTGAGAATCCAGTCCACTCCCCTTCCCCAG
TGAATGAGGTACAGATGAGTGACTACGTAACTGATGGAAATACTGTAACTGATCGCAGTACTGTAAATAA
CATCGTGGTTCCCCAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4975683), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60834. Forward Primer - name:060834_F_IRAV75_b08_Tfpi, sequence:GGGACCTGTCTCCGGATT; Reverse Primer - name:060834_R_SP6_IRAV75_b08_Tfpi, sequence:GACTGGGGAACCACGATG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20395 same embryo
 EMAGE:20391 same embryo
 EMAGE:20393 same embryo
 EMAGE:20392 same embryo
 EurExpress:euxassay_012616 same experiment
 MGI:4828674 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS