Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20398

Pf4 platelet factor 4 ( MGI:1888711)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398
"Pseudo-wholemount" of euxassay_012683. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012683_01 euxassay_012683_02 euxassay_012683_03 euxassay_012683_04
EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398
euxassay_012683_05 euxassay_012683_06 euxassay_012683_07 euxassay_012683_08 euxassay_012683_09
EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398
euxassay_012683_10 euxassay_012683_11 euxassay_012683_12 euxassay_012683_13 euxassay_012683_14
EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398 EMAGE:20398
euxassay_012683_15 euxassay_012683_16 euxassay_012683_17 euxassay_012683_18 euxassay_012683_19
EMAGE:20398 EMAGE:20398 EMAGE:20398
euxassay_012683_20 euxassay_012683_21 euxassay_012683_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20398Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20398_wholemount_strong.wlz
20398_wholemount_moderate.wlz
20398_wholemount_weak.wlz
20398_wholemount_possible.wlz
20398_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20398_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon meninges
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon meninges
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata
moderate moderate
single cellmoderate expression: see section 17
hindbrain meninges
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19
midbrain meninges
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 16 17
spinal cord meninges
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14
liver lobe
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31929
Entity Detected:Pf4, platelet factor 4 ( MGI:1888711)
Sequence:sense strand is shown

>T31929
TGAGCTGCTGCTTCTGGGCCTGTTGTTTCTGCCAGCGGTGGTTGCTGTCACCAGCGCTGGTCCCGAAGAA
AGCGATGGAGATCTTAGCTGTGTGTGTGTGAAGACCATCTCCTCTGGGATCCATCTTAAGCACATCACCA
GCCTGGAGGTGATCAAGGCAGGACGCCACTGTGCGGTTCCCCAGCTCATAGCCACCCTGAAGAATGGGAG
GAAAATTTGCCTGGACCGGCAAGCACCCCTATA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30280161), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61397. Forward Primer - name:061397_F_IRAW6_b01_Cxcl4, sequence:TGAGCTGCTGCTTCTGGG; Reverse Primer - name:061397_R_SP6_IRAW6_b01_Cxcl4, sequence:ATATAGGGGTGCTTGCCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20396 same embryo
 EMAGE:20399 same embryo
 EMAGE:20397 same embryo
 EurExpress:euxassay_012683 same experiment
 MGI:4827161 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS