Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20399

Mt3 metallothionein 3 ( MGI:97173)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399
"Pseudo-wholemount" of euxassay_012667. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012667_01 euxassay_012667_02 euxassay_012667_03 euxassay_012667_04
EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399
euxassay_012667_05 euxassay_012667_06 euxassay_012667_07 euxassay_012667_08 euxassay_012667_09
EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399
euxassay_012667_10 euxassay_012667_11 euxassay_012667_12 euxassay_012667_13 euxassay_012667_14
EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399 EMAGE:20399
euxassay_012667_15 euxassay_012667_16 euxassay_012667_17 euxassay_012667_18 euxassay_012667_19
EMAGE:20399
euxassay_012667_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20399Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20399_wholemount_strong.wlz
20399_wholemount_moderate.wlz
20399_wholemount_weak.wlz
20399_wholemount_possible.wlz
20399_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20399_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 07 08 12 13
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 12 13 14 15 16 17 18 19 weak expression: see section 09
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11
pons ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
midbrain ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 14 15
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 13 14 15 16 17 18
ventral grey horn
strong strong
regionalstrong expression: see section 06 weak expression: see section 07 08 09 10 11
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 07 08 09
dorsal root ganglion
weak weak
regionalweak expression: see section 06 08 09 10 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31926
Entity Detected:Mt3, metallothionein 3 ( MGI:97173)
Sequence:sense strand is shown

>T31926
GTGGTTCCTGCACCTGCTCGGACAAATGCAAGTGCAAGGGCTGCAAATGCACGAACTGCAAGAAGAGCTG
CTGCTCCTGCTGCCCTGCCGGATGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGTGAAGAGGGGGCC
AAGGCAGAGGCCGAGAAATGCAGCTGCTGCCAGTGAGGACCCAGACCCTCCCACACAGCCTATGTAAATA
GTGCTGGGTGTCCCTGGTGGGGCACAACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6600430), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61288. Forward Primer - name:061288_F_IRAW5_h10_Mt3, sequence:GTGGTTCCTGCACCTGCT; Reverse Primer - name:061288_R_SP6_IRAW5_h10_Mt3, sequence:ACAGTTGTGCCCCACCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20396 same embryo
 EMAGE:20398 same embryo
 EMAGE:20397 same embryo
 EurExpress:euxassay_012667 same experiment
 MGI:4826479 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS