Type: | in situ hybridisation probe |
Identifier: | MGI:1276342 |
Entity Detected: | Actc1, actin, alpha, cardiac muscle 1 ( MGI:87905) |
Sequence: | sense strand is shown
>MGI:1276342
AGGCGACTGACACCCAGTGCCTGCCACCAGCGCCAGCCCAGCTGAATCCAGCCGCCCCTAGCACGGTGAG
TCCCAGCCTTGCTCCCTGCAGGACCTTGTCAGCACTGTGCTTTTGTGCTCTTGGATCC
|
| nt 662 - nt 789 of M59866.1 |
Notes: | The probe used in this study by Sassoon et al., 1988 [PMID:3075543] is described as a BamHI genomic fragment which includes the first non-coding exon (see Fig 1B therein).
NB. Note that the target sequence for this probe is the reverse and complement of the sequence in the link above (the sequence in M59866 is the reverse strand). |
Chemistry: | RNA |
Strand: | antisense |
Label: | S35 |