Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20552

Ly6h lymphocyte antigen 6 complex, locus H ( MGI:1346030)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552
"Pseudo-wholemount" of euxassay_013816. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013816_01 euxassay_013816_02 euxassay_013816_03 euxassay_013816_04
EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552
euxassay_013816_05 euxassay_013816_06 euxassay_013816_07 euxassay_013816_08 euxassay_013816_09
EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552
euxassay_013816_10 euxassay_013816_11 euxassay_013816_12 euxassay_013816_13 euxassay_013816_14
EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552
euxassay_013816_15 euxassay_013816_16 euxassay_013816_17 euxassay_013816_18 euxassay_013816_19
EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552 EMAGE:20552
euxassay_013816_20 euxassay_013816_21 euxassay_013816_22 euxassay_013816_23 euxassay_013816_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20552Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20552_wholemount_strong.wlz
20552_wholemount_moderate.wlz
20552_wholemount_weak.wlz
20552_wholemount_possible.wlz
20552_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20552_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pituitary gland
weak weak
regionalweak expression: see section 11 12 13 14 15
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 11 12 13 14 15 16 weak expression: see section 09 10
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 11 12 13 14 15 16 17 weak expression: see section 09 10
lateral ventricle
moderate moderate
regionalmoderate expression: see section 06
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 07 08 09 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 14 15 weak expression: see section 04 08 16 17 18 19 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 12 13 14 15 weak expression: see section 08 09 10 11 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 12 13 14 15 weak expression: see section 08 09 10 11 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 weak expression: see section 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 weak expression: see section 02 07 08 17 18 19 20 21 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09 11 12 13 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 10 15 16 17 18 19
neural retina
weak weak
regionalweak expression: see section 01 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 07 08 09 10 15 16
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38301
Entity Detected:Ly6h, lymphocyte antigen 6 complex, locus H ( MGI:1346030)
Sequence:sense strand is shown

>T38301
CTCTTTCAGGCCCTATCGGAGCATGCTGCCTGCAGCCATGAAGAGCCTCGGTCTGGCGCTGCTGGCCTTG
CTTCTCTGCCCCTCGCCGGCCCATGGCCTGTGGTGCCAGGACTGCACCCTGGCCAATTCCAGCCATTGCG
CTCCGAAGCAGTGCCAGCCCACCGATACCGTTTGTGCCAGCGTGCGGATCACCGACCCCAGCAGCAGCAG
GAAGGATCATTCTGTGAACAAGATGTGTGCTTCCTCCTGCGACTTCGTTAAGCGGCACTTTTTCTCAGAC
TATCTGATGGGGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 148318. Forward Primer - name:148318_F_cDNA_Ly6h, sequence:CTCTTTCAGGCCCTATCGGAG; Reverse Primer - name:148318_N_SP6_cDNA_Ly6h, sequence:AACCCCATCAGATAGTCTGAGAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20554 same embryo
 EMAGE:20555 same embryo
 EMAGE:20553 same embryo
 EurExpress:euxassay_013816 same experiment
 MGI:4826031 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS