Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20557

Acaa2 acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) ( MGI:1098623)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557
"Pseudo-wholemount" of euxassay_012769. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012769_01 euxassay_012769_02 euxassay_012769_03 euxassay_012769_04
EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557
euxassay_012769_05 euxassay_012769_06 euxassay_012769_07 euxassay_012769_08 euxassay_012769_09
EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557
euxassay_012769_10 euxassay_012769_11 euxassay_012769_12 euxassay_012769_13 euxassay_012769_14
EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557 EMAGE:20557
euxassay_012769_15 euxassay_012769_16 euxassay_012769_17 euxassay_012769_18 euxassay_012769_19
EMAGE:20557 EMAGE:20557 EMAGE:20557
euxassay_012769_20 euxassay_012769_21 euxassay_012769_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20557Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20557_wholemount_strong.wlz
20557_wholemount_moderate.wlz
20557_wholemount_weak.wlz
20557_wholemount_possible.wlz
20557_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20557_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vibrissa
strong strong
regionalstrong expression: see section 03
diencephalon roof plate
strong strong
regionalstrong expression: see section 13
choroid invagination
strong strong
regionalstrong expression: see section 07 08 09 10 11 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
tongue epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14
oral epithelium
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
bladder
strong strong
regionalstrong expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38273
Entity Detected:Acaa2, acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) ( MGI:1098623)
Sequence:sense strand is shown

>T38273
AGTCCCCCTACTGTGTCAGAAATGTGCGCTTCGGAACCAAATTTGGATTAGATCTCAAGCTGGAAGATAC
TTTGTGGGCAGGATTAACGGATCAACATGTTAAGCTGCCCATGGGAATGACTGCAGAGAACCTTGCTGCA
AAATACAACATAAGCAGAGAAGACTGTGACAGATACGCCTTGCAGTCTCAGCAGAGGTGGAAAGCTGCTA
ACGAGGCTGGCTACTTCAATGAGGAGATGGCACCCATTGAGGTGAAGACGAAGAAAGGCAAACAGACCAT
GCAAGTGGACGAGCACGCTCGACCCCAAACCACCCTGGAGCAACTGCAGAAGCTCCCGTCCGTGTTCAAG
AAAGACGGGACAGTCACAGCAGGGAACGCCTCGGGGGTGTCTGACGGTGCTGGGGCCGTCATCATAGCCA
GCGAAGATGCTGTCAAAAAACATAACTTCACGCCCCTGGCCAGAGTCGTGGGCTACTTCGTGTCCGGATG
CGATCCTACTATCATGGGTATTGGTCCAGTCCCTGCTATCAATGGAGCATTGAAGAAAGCTGGGCTGAGT
CTTAAGGACATGGATTTGATAGACGTGAACGAAGCTTTTGCCCCTCAGTTCTTGTCTGTTCAGAAGGCCC
TGGATCTTGACCCCAGCAAAACCAATGTGAGTGGAGGCGCCATTGCCCTGGGTCACCCGCTGGGAGGATC
TGGCTCCAGAATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 142865. Forward Primer - name:142865_F_cDNA_Acaa2, sequence:AGTCCCCCTACTGTGTCAGAAA; Reverse Primer - name:142865_N_SP6_cDNA_Acaa2, sequence:GATTCTGGAGCCAGATCCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20558 same embryo
 EMAGE:20556 same embryo
 EurExpress:euxassay_012769 same experiment
 MGI:4822895 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS