Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20560

Zfp459 zinc finger protein 459 ( MGI:3040701)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560
"Pseudo-wholemount" of euxassay_013819. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013819_01 euxassay_013819_02 euxassay_013819_03 euxassay_013819_04
EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560
euxassay_013819_05 euxassay_013819_06 euxassay_013819_07 euxassay_013819_08 euxassay_013819_09
EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560
euxassay_013819_10 euxassay_013819_11 euxassay_013819_12 euxassay_013819_13 euxassay_013819_14
EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560
euxassay_013819_15 euxassay_013819_16 euxassay_013819_17 euxassay_013819_18 euxassay_013819_19
EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560 EMAGE:20560
euxassay_013819_20 euxassay_013819_21 euxassay_013819_22 euxassay_013819_23 euxassay_013819_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20560Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20560_wholemount_strong.wlz
20560_wholemount_moderate.wlz
20560_wholemount_weak.wlz
20560_wholemount_possible.wlz
20560_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20560_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 17 weak expression: see section 02 03 04 06 07 16 18 19 20
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 17 18
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38103
Entity Detected:Zfp459, zinc finger protein 459 ( MGI:3040701)
Sequence:sense strand is shown

>T38103
TCCTACCAGTGTGAAGATGTGGTATGATGGTTTGTATATGCTTGGCTCAGGGAGTTGCAGTATTAGGAGG
TGTGGCCTTGTTGGAGTAAGTGTGTCAATGTGGGTGTGGGGGTGGGCGCTAATACCCTTGTCCTACAAGC
CAGTCTTGTAGCAGCCTTCAGATGAAGATGTACAACTCTTAGCTCTTCCTGCACCATGTCTGCCTGGATG
CTGCCATGCTCCTGCCTTGATGATAATAGACTAAGTCTTTAATCTGTAAGCAAGCCTCTATTAAGTGTTG
TTCTTACAAGAGTTGCTTTGGTTATGGTGTCTGTTCACAGCAATAAACCCCTAAGACATATGGGAAGTGT
GATAAAGCCTAGTTAATCTTGATAGCCTTACTCAACACAGGATAGTTCATAATGGAGTGAAGTCCTATGA
ATTTTTAAAATATTTAATCTTCTTCCACTCTTAAAACAAATCTGTGCTGCCCAGTTTTATGTCAGCTTGA
CAGGCAAACTAGAGCTATCTGAAAGGACAGAACTTCAACTGAGTAAATGTTTGCATAAGATCCAGCTTTA
ACTGTTTTCTTAATTAGTGATTGATGGGAGGGCCCAGCCCATTGTGAGTGCGGTCATTCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88396. Forward Primer - name:088396_F_cDNA_Zfp459, sequence:TCCTACCAGTGTGAAGATGTGG; Reverse Primer - name:088396_N_SP6_cDNA_Zfp459, sequence:AGGAATGACCGCACTCACAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20561 same embryo
 EMAGE:20563 same embryo
 EMAGE:20562 same embryo
 EurExpress:euxassay_013819 same experiment
 MGI:4829310 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS