Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20597

Col2a1 collagen, type II, alpha 1 ( MGI:88452)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597
"Pseudo-wholemount" of euxassay_013804. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013804_01 euxassay_013804_02 euxassay_013804_03 euxassay_013804_04
EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597
euxassay_013804_05 euxassay_013804_06 euxassay_013804_07 euxassay_013804_08 euxassay_013804_09
EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597
euxassay_013804_10 euxassay_013804_11 euxassay_013804_12 euxassay_013804_13 euxassay_013804_14
EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597 EMAGE:20597
euxassay_013804_15 euxassay_013804_16 euxassay_013804_17 euxassay_013804_18 euxassay_013804_19
EMAGE:20597 EMAGE:20597 EMAGE:20597
euxassay_013804_20 euxassay_013804_21 euxassay_013804_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20597Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20597_wholemount_strong.wlz
20597_wholemount_moderate.wlz
20597_wholemount_weak.wlz
20597_wholemount_possible.wlz
20597_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20597_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 04 06 07 20 21 22
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 04 06 07 20 21 22 moderate expression: see section 03
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 20 21 22 moderate expression: see section 03
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 04 05 17 moderate expression: see section 03 16
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 04 05 16 17 moderate expression: see section 02 03
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05 16 17 moderate expression: see section 02 03
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 02 03
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 04 05 16 moderate expression: see section 03
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon lateral wall ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 09 10 15 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 13 weak expression: see section 03 04 05 06 07 08 09 10 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 10 11 13 14
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 08 09 10 11 13 14 15 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 08 09 10 11 13 14 15 16 17
spinal cord floor plate
weak weak
regionalweak expression: see section 12 13
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart valve
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14 15
esophagus
moderate moderate
regionalmoderate expression: see section 12 13
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 05 06 07 08 09
hindgut
weak weak
regionalweak expression: see section 12 13 14
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 12 13 14 15 16 17 18 19
metanephros
weak weak
regionalweak expression: see section 06 07 08 15 16 17 18 19
cricoid cartilage
strong strong
regionalstrong expression: see section 12 13 14
thyroid cartilage
strong strong
regionalstrong expression: see section 11 12 13 14 15
trachea cartilaginous ring
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 weak expression: see section 13 14 15
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 09 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38288
Entity Detected:Col2a1, collagen, type II, alpha 1 ( MGI:88452)
Sequence:sense strand is shown

>T38288
GTCCTACTGGAGTGACTGGTCCTAAGGGAGCCCGAGGTGCCCAAGGTCCCCCGGGAGCCACCGGATTCCC
TGGAGCTGCTGGCCGAGTTGGACCCCCAGGTGCTAATGGCAATCCTGGACCCGCCGGTCCCCCTGGTCCT
GCTGGAAAAGATGGTCCCAAAGGTGTTCGAGGAGACAGTGGCCCCCCTGGCAGAGCTGGTGACCCCGGTC
TTGAAGGTCCTGCAGGAGCTCCTGGCGAGAAAGGAGAACCTGGAGATGATGGTCCCTCTGGTCTTGATGG
TCCTCCAGGTCCCCAGGGGCTGGCTGGTCAAAGGGGCATTGTTGGTCTGCCTGGTCAGCGTGGTGAGAGA
GGATTCCCCGGCCTTCCCGGCCCATCGGGTGAGCCCGGCAAGCAGGGTGCACCTGGCGCGTCTGGAGACA
GAGGTCCTCCTGGTCCTGTGGGGCCTCCTGGCCTGACAGGGCCTGCAGGTGAACCTGGACGAGAGGGCAG
CCCTGGTGCTGATGGACCCCCTGGAAGAGATGGTGCAGCTGGAGTCAAGGGAGATCGTGGTGAGACTGGA
GCACTGGGTGCCCCTGGAGCTCCTGGGCCCCCAGGCTCTCCTGGTCCTGCTGGCCCAACTGGCAAACAAG
GAGACAGAGGAGAGGCTGGTGCACAAGGTCCTATGGGTCCCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 145311. Forward Primer - name:145311_F_cDNA_Col2a1, sequence:GTCCTACTGGAGTGACTGGTCC; Reverse Primer - name:145311_N_SP6_cDNA_Col2a1, sequence:GAGGGACCCATAGGACCTTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20594 same embryo
 EMAGE:20596 same embryo
 EMAGE:20595 same embryo
 EurExpress:euxassay_013804 same experiment
 MGI:4823989 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS