Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20633

Specc1 sperm antigen with calponin homology and coiled-coil domains 1 ( MGI:2442356)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633
"Pseudo-wholemount" of euxassay_013924. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013924_01 euxassay_013924_02 euxassay_013924_03 euxassay_013924_04
EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633
euxassay_013924_05 euxassay_013924_06 euxassay_013924_07 euxassay_013924_08 euxassay_013924_09
EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633
euxassay_013924_10 euxassay_013924_11 euxassay_013924_12 euxassay_013924_13 euxassay_013924_14
EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633
euxassay_013924_15 euxassay_013924_16 euxassay_013924_17 euxassay_013924_18 euxassay_013924_19
EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633 EMAGE:20633
euxassay_013924_20 euxassay_013924_21 euxassay_013924_22 euxassay_013924_23 euxassay_013924_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20633Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20633_wholemount_strong.wlz
20633_wholemount_moderate.wlz
20633_wholemount_weak.wlz
20633_wholemount_possible.wlz
20633_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20633_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14
aorta
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 19
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38408
Entity Detected:Specc1, sperm antigen with calponin homology and coiled-coil domains 1 ( MGI:2442356)
Sequence:sense strand is shown

>T38408
GAGGAATGTCGAGTTACCTTGGAAGGCTTGAAAATGGAGAATGGGTCCTTGAAGGCTCTTTTGGAGGCTG
ATAAGCAAAAAGCCATAGAGGCCAGCAGTACTGTGGGGCAGACAGCAGAGAACTTCGAGGTTCAGGAGAT
GCTGAAAGTGGCTCGAGCTGAGAAAGATCAGTTGCAGCTGTCTTGCACAGAGCTCAGACAAGAATTGCTA
AAGGCAAATGGTGAAATTAAACATGTTTCCAGCCTGCTAGCTAAGATGGAGAAAGATTATTCGTACCTGA
AAGAAGTCTGTGATCATCAAGCAGAACAGCTGAGCAGAACCAGCCTAAAATTACAAGAGAAAGCTTCAGA
AAGTGACGCAGAAATCAAAGACATGAAAGAGACCATATTTGAATTGGAAGACCAGGTGGAGCAGCATCGC
GCCGTCAAGTTACACAATAACCAGCTCATCAGTGAGCTGGAAGGCAGTGTGATCAAGCTGGAGGAGCAGA
AGTCAGACCTAGAGCGGCAGTTAAAGACGCTAACAAAACAGATAAAGGAGGAAACAGAAGAATGGAGGCG
ATTCCAGGCAGACTTACAGACTGCAGTGGTAGTGGCCAACGACATCAAGTGTGAGGCTCAGCAGGAGCTG
CGCACTGTGAAGAGGAGGTTGCTGGAGGAGGAAGAGAAAAATGCCAGGCTGCAGAAGGAGCTGGGAGACA
TACAGGGGCACAGCAGACCTGTGAATGAAGAGCCAGAGCCCTCAGAGGCCGATGCTGCTGGCCGGTGGCG
TGGAGTCTATGTCAACAGAACATCTCCAGCTCCTTCAGACTCTGCAACCACAGTAAAGTCACTGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 112122. Forward Primer - name:112122_F_cDNA_LOC432572, sequence:GAGGAATGTCGAGTTACCTTGG; Reverse Primer - name:112122_N_SP6_cDNA_LOC432572, sequence:ATCAGTGACTTTACTGTGGTTGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20635 same embryo
 EMAGE:20632 same embryo
 EMAGE:20634 same embryo
 EurExpress:euxassay_013924 same experiment
 MGI:4824184 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS