Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20636

Pou4f1 POU domain, class 4, transcription factor 1 ( MGI:102525)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636
"Pseudo-wholemount" of euxassay_013839. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013839_01 euxassay_013839_02 euxassay_013839_03 euxassay_013839_04
EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636
euxassay_013839_05 euxassay_013839_06 euxassay_013839_07 euxassay_013839_08 euxassay_013839_09
EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636
euxassay_013839_10 euxassay_013839_11 euxassay_013839_12 euxassay_013839_13 euxassay_013839_14
EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636
euxassay_013839_15 euxassay_013839_16 euxassay_013839_17 euxassay_013839_18 euxassay_013839_19
EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636 EMAGE:20636
euxassay_013839_20 euxassay_013839_21 euxassay_013839_22 euxassay_013839_23 euxassay_013839_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20636Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20636_wholemount_strong.wlz
20636_wholemount_moderate.wlz
20636_wholemount_weak.wlz
20636_wholemount_possible.wlz
20636_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20636_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 12 14 15 17 18 moderate expression: see section 10 11 16
pons mantle layer
strong strong
regionalstrong expression: see section 15 16 17 18
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 17 18 19
dorsal grey horn
strong strong
regionalstrong expression: see section 08 09 moderate expression: see section 10 11 12 14 15 weak expression: see section 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 12 13 14 17 18 19 moderate expression: see section 09 10 11 15 16
neural retina
strong strong
regionalstrong expression: see section 02 03 22 23 moderate expression: see section 01 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38789
Entity Detected:Pou4f1, POU domain, class 4, transcription factor 1 ( MGI:102525)
Sequence:sense strand is shown

>T38789
TACCGGGGATAAATGTTGAGTCACAAAAACTTCAATTTGCACTATGAGTTTCCAAAATAGAAAATCATGT
GTGATATTTACATACTAATAATCCAAGCTGCTGACGGATTTTAAGGAAAAATTTTTTGAGAAAGACAGTT
TGAGAAAGAAAGAGAGAGAGAGAGAAATGTGGTTTAGTGAAATGCCTGCTTTGTTGTGTAGAAGATCCCC
TTTGGATCTCATGTGGAGATCGGTCTGTTACTATCATTTAACCATAACTAAAGATGAAAACGGAAGAGAT
AGGGGGAACACTGTTTAACAAGACTGAAATCATGCATGGCTCGAAAGGTGCAGAAAGAAATGTGATTAGG
TCTCACTCTGGGTAGGCGTTGTTATTTATTTAATTATGTTGTATGTCATTGTTTGCAGCACAAAACATTC
TATGCATTGAAACTGAGCACTAAACTGGGCTAGCTTTCTGGTAGACCATTTTTTTGTGGATAGTGTGATT
TCACAGTCTACTGCCTGTTTCCACTGAAAACACATTATTGTAAATATTTTCTTTCATGCACAGGCCCACA
CACAGTGGTTACAAACTGCCAGTGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 236242. Forward Primer - name:165397_F_cDNA_Pou4f1, sequence:TACCGGGGATAAATGTTGAGTC; Reverse Primer - name:165397_N_SP6_cDNA_Pou4f1, sequence:AACACTGGCAGTTTGTAACCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4827341 same experiment
 EurExpress:euxassay_013839 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS