Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20701

Lrp2 low density lipoprotein receptor-related protein 2 ( MGI:95794)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701
"Pseudo-wholemount" of euxassay_013970. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013970_01 euxassay_013970_02 euxassay_013970_03 euxassay_013970_04
EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701
euxassay_013970_05 euxassay_013970_06 euxassay_013970_07 euxassay_013970_08 euxassay_013970_09
EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701
euxassay_013970_10 euxassay_013970_11 euxassay_013970_12 euxassay_013970_13 euxassay_013970_14
EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701
euxassay_013970_15 euxassay_013970_16 euxassay_013970_17 euxassay_013970_18 euxassay_013970_19
EMAGE:20701 EMAGE:20701 EMAGE:20701 EMAGE:20701
euxassay_013970_20 euxassay_013970_21 euxassay_013970_22 euxassay_013970_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20701Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20701_wholemount_strong.wlz
20701_wholemount_moderate.wlz
20701_wholemount_weak.wlz
20701_wholemount_possible.wlz
20701_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20701_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 moderate expression: see section 05 06 07 08 18 19 20 weak expression: see section 04
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 09 10 12 13 14
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18
pons ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 08 09 weak expression: see section 10 11 12
cochlea
strong strong
regionalstrong expression: see section 04 05 06 07 14 15 16
utricle
strong strong
regionalstrong expression: see section 01 02 03 04 16 17 18 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
kidney calyx
strong strong
regionalstrong expression: see section 04 05 06 07 08 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39396
Entity Detected:Lrp2, low density lipoprotein receptor-related protein 2 ( MGI:95794)
Sequence:sense strand is shown

>T39396
TATTCGGGTCAGGAAGTCTGATGGTGGTGATATGACCGTTGTTCGACGTGGCATCAGCAGCATAATGCAC
GTGAAAGCGTACGATGCTGACCTCCAGACCGGAACTAACTACTGCAGTCAGACCACCCATCCCAACGGCG
ACTGCAGCCATTTCTGCTTCCCAGTTCCAAACTTCCAGCGGGTGTGTGGCTGCCCCTATGGAATGAAGCT
TCAGAGGGACCAAATGACTTGTGAGGGAGACCCAGCCCGAGAGCCCCCCACACAGCAGTGTGGCTCCTCT
TCCTTTCCCTGCAACAATGGCAAGTGTGTGCCCAGTATCTTCCGCTGTGATGGAGTGGATGATTGCCATG
ACAACAGTGATGAGCATCAGTGTGGGGCACTTAATAACACCTGCTCATCTTCGGCTTTTACTTGTGTCCA
CGGTGGACAGTGCATCCCTGGCCAGTGGCGCTGTGACAAACAGAATGACTGTCTAGATGGCAGTGATGAG
CAAAACTGCCCCACTCGTTCACCGTCGTCTACTTGCCCGCCCACCTCCTTCACCTGCGACAATCACATGT
GTATCCCCAAAGAGTGGGTCTGTGACACAGACAATGATTGTTCGGATGGATCAGATGAAAAGAACTGTCA
AGCTTCGGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76562. Forward Primer - name:076562_F_cDNA_Lrp2, sequence:TATTCGGGTCAGGAAGTCTGAT; Reverse Primer - name:076562_N_SP6_cDNA_Lrp2, sequence:CCCCGAAGCTTGACAGTTCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20700 same embryo
 EMAGE:20697 same embryo
 EMAGE:20696 same embryo
 EMAGE:20699 same embryo
 EMAGE:20698 same embryo
 EurExpress:euxassay_013970 same experiment
 MGI:4825983 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS