Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20707

Rnf150 ring finger protein 150 ( MGI:2443860)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707
"Pseudo-wholemount" of euxassay_014053. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014053_01 euxassay_014053_02 euxassay_014053_03 euxassay_014053_04
EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707
euxassay_014053_05 euxassay_014053_06 euxassay_014053_07 euxassay_014053_08 euxassay_014053_09
EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707
euxassay_014053_10 euxassay_014053_11 euxassay_014053_12 euxassay_014053_13 euxassay_014053_14
EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707
euxassay_014053_15 euxassay_014053_16 euxassay_014053_17 euxassay_014053_18 euxassay_014053_19
EMAGE:20707 EMAGE:20707 EMAGE:20707 EMAGE:20707
euxassay_014053_20 euxassay_014053_21 euxassay_014053_22 euxassay_014053_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20707Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20707_wholemount_strong.wlz
20707_wholemount_moderate.wlz
20707_wholemount_weak.wlz
20707_wholemount_possible.wlz
20707_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20707_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
single cellweak expression: see section 08 09 15
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 19
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 17
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 16 17 18 19 20 21 weak expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 05 17 18 weak expression: see section 07 16
dorsal grey horn
weak weak
single cellweak expression: see section 12 13
ventral grey horn
weak weak
single cellweak expression: see section 10 14
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 09 13 14 15 16 17 weak expression: see section 07 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39788
Entity Detected:Rnf150, ring finger protein 150 ( MGI:2443860)
Sequence:sense strand is shown

>T39788
GAGAGGTTTCAGTATGTTGGGGGAGTATCGGAGAGTCTGGTTCGGGAGAGGGTTCAAGCTGTGGAGTGTC
TTCTCCCAGGAGAATTTGGAAAGTGAGATTTGGGAAACAGGGCTGAGATATTGTTCTTGTTAGTGACCCG
TTTCAGCACCTGTTTGGAACCGGAAGTTCTAATAACTTGTCTCTGCGCTTCGTTGTGTGTATCAGATATA
CATACCTGGTGCAAGTGTTTGTGTATCAAGAGGCAGGTCAACTTACCTGTCTGCAGCTGACCATCGGCAA
ACTGCTCTCCCAAGTCAGGTTTCAGCCCTTCTCAGGAGCCCTTCCCCTTGCTGGGACCATAAGTAAATAA
TATTCAAAGCTCTGCCAGGTTGTCATCTAGAGAGATGGACTGACGGGGAGCATGGGTGAAACATTGCAAT
GCCCAACAAGCCAAGAATAGCCACAACGTTAGAATTACTTTCTACTGCTGTGTTGTCTTCTGCCTGCATC
TGGTTTCGAGATGCACTCAAGAAAGACCTTTGTCAGTGACCACAGGGGCCAGACTAAAAATAAGCATGAT
TGCCCCAATTCAACACAGTCTATAAACAGTGTTTTCGTGAGAGAAGTAACAGAAGCAACAAGACTATGTT
ATTCATATTTATTAGCACAGGCCACTGGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70087. Forward Primer - name:070087_F_cDNA_Rnf150, sequence:GAGAGGTTTCAGTATGTTGGGG; Reverse Primer - name:070087_N_SP6_cDNA_Rnf150, sequence:AACCAGTGGCCTGTGCTAATAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20709 same embryo
 EMAGE:20708 same embryo
 EMAGE:20710 same embryo
 EMAGE:20711 same embryo
 EurExpress:euxassay_014053 same experiment
 MGI:4827765 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS