Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20717

Pcdh11x protocadherin 11 X-linked ( MGI:2442849)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717
"Pseudo-wholemount" of euxassay_014007. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014007_01 euxassay_014007_02 euxassay_014007_03 euxassay_014007_04
EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717
euxassay_014007_05 euxassay_014007_06 euxassay_014007_07 euxassay_014007_08 euxassay_014007_09
EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717
euxassay_014007_10 euxassay_014007_11 euxassay_014007_12 euxassay_014007_13 euxassay_014007_14
EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717
euxassay_014007_15 euxassay_014007_16 euxassay_014007_17 euxassay_014007_18 euxassay_014007_19
EMAGE:20717 EMAGE:20717 EMAGE:20717 EMAGE:20717
euxassay_014007_20 euxassay_014007_21 euxassay_014007_22 euxassay_014007_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20717Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20717_wholemount_strong.wlz
20717_wholemount_moderate.wlz
20717_wholemount_weak.wlz
20717_wholemount_possible.wlz
20717_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20717_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 21
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 02 04 19
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 20 21
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 02 04 19
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 20 21
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 02 03 19
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 20 21
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 03
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 20
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 20 21 weak expression: see section 22
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 14 15 16
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 10 11 12 13 16 17 18 19 20 21 22 23 moderate expression: see section 05 06 07 08 09 14 15
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17 18
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 17 18 19 20 moderate expression: see section 08 15 16
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 17 18 moderate expression: see section 08 09 10 11 12 13 14 15 16
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 11 17 18 moderate expression: see section 08 09 10 12 13 14 15 16
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 17 18 19 20
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 07 08 17
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 06 07 17 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 01 05 06 20 23 weak expression: see section 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17
bladder
moderate moderate
single cellmoderate expression: see section 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39608
Entity Detected:Pcdh11x, protocadherin 11 X-linked ( MGI:2442849)
Sequence:sense strand is shown

>T39608
TCCTCACCAACCACTGACTATGTCAAGATCATGGTTGCCATTGTGGCTGGCACCATAACTGTTGTCCTAG
TTATTTTCATCACTGCTGTAGTAAGATGCCGCCAACCACCACATCTTAAGGCTTCTCAGAAAAACAAACA
GAATTCTGAGTGGGTTACTCCAAACCCAGAAAACAGGCAGATGATTATGATGAAGAAGAAGAAGAAAAAG
AAGAAGAAGCATCCCCCCAAGAACTTGCTGCTTAATTTTGTCACTATTGAAGAAGCAAAGCCAGATGACG
GTGAAAATGAGAGAAACAGTGTCACACTAGATCTTCCAATTGAGCTGGAAGAGCAAACCATGGGCAAATA
CAACTGGGGCACTACACCTACTACTTTCAAACCTGATAGCCCTGATTTGGCTCGACACTACAAATCGGCC
TCTCCTCAGCCTGCATTCCAGATCCAGCCTGAAACGCCCCTGAACTCAAAGCACCACATCATTCAGGAAC
TGCCTCTTGATAATACCTTCGTTGGCTGTGATTCCATCTCCAAGTGCTCCTCCAGCAGTTCTGATCCCTA
CAGTGTTTCTGAGTGTAGCTATCCAGTGACAACTTTCAAGGCCCCTGTGTCTGTGCATATCAGACCGACA
ATGAAGGAGGTGGTAAGATCTCACACACCCATGAAAGAGGCAACCACTGTGGAAATCTGGACTCATCCAC
ATCCACAGGGAGATTATGAAATACTATCAAAAGTAGCACTAAGTGGACATAATAAAATTGGTACTGAGTT
TTGTCTTTGTGTTTGTTTTGTTTTGCTTCCTTTGCCTCCATTTTATCCAAATCAGCGGCGATCTGATGGG
AAAAAAGCAGGAAAGTCCCAGAGACGTGTCACATTTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86816. Forward Primer - name:086816_F_cDNA_Pcdh11x, sequence:TCCTCACCAACCACTGACTATG; Reverse Primer - name:086816_N_SP6_cDNA_Pcdh11x, sequence:TGAAATGTGACACGTCTCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20714 same embryo
 EMAGE:20719 same embryo
 EMAGE:20716 same embryo
 EMAGE:20718 same embryo
 EMAGE:20715 same embryo
 EurExpress:euxassay_014007 same experiment
 MGI:4827078 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS