EMAGE mouse gene expression spatial database

EMAGE:21008

Sst somatostatin ( MGI:98326)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_017925. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_017925_01	euxassay_017925_02	euxassay_017925_03	euxassay_017925_04

euxassay_017925_05	euxassay_017925_06	euxassay_017925_07	euxassay_017925_08	euxassay_017925_09

euxassay_017925_10	euxassay_017925_11	euxassay_017925_12	euxassay_017925_13	euxassay_017925_14

euxassay_017925_15	euxassay_017925_16	euxassay_017925_17	euxassay_017925_18	euxassay_017925_19

euxassay_017925_20

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T51046
Entity Detected:	Sst, somatostatin ( MGI:98326)
Sequence:	sense strand is shown >T51046 TGAAGGAGACGCTACCGAAGCCGTCGCTGCTGCCTGAGGACCTGCGACTAGACTGACCCACCGCGCTCCA GCTTGGCTGCCTGAGGCAAGGAAGATGCTGTCCTGCCGTCTCCAGTGCGCCCTGGCTGCGCTCTGCATCG TCCTGGCTTTGGGCGGTGTCACCGGCGCGCCCTCGGACCCCAGACTCCGTCAGTTTCTGCAGAAGTCTCT GGCGGCTGCCACCGGGAAACAGGAACTGGCCAAGTACTTCTTGGCAGAGCTGCTGTCCGAGCCCAACCAG ACAGAGAATGATGCCCTGGAGCCCGAGGATTTGCCCCAGGCAGCTGAGCAGGACGAGATGAGGCTGGAGC TGCAGAGGTCTGCCAACTCGAACCCAGCAATGGCACCCCGGGAACGCAAAGCTGGCTGCAAGAACTTCTT CTGGAAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCTCCCCCA AACCCCATATCTCTTCCTTAACTCCTGGCCCCCGATGCTCAACTTGACCCTGCA
Notes:	The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TGAAGGAGACGCTACCGAAGCC; Reverse Primer - name:unspecified, sequence:TGCAGGGTCAAGTTGAGCATCGG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_017925 same experiment
	EMAGE:21006 same embryo
	EMAGE:21007 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source