Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21016

Epha3 Eph receptor A3 ( MGI:99612)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016
"Pseudo-wholemount" of euxassay_018957. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018957_01 euxassay_018957_02 euxassay_018957_03 euxassay_018957_04
EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016
euxassay_018957_05 euxassay_018957_06 euxassay_018957_07 euxassay_018957_08 euxassay_018957_09
EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016
euxassay_018957_10 euxassay_018957_11 euxassay_018957_12 euxassay_018957_13 euxassay_018957_14
EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016
euxassay_018957_15 euxassay_018957_16 euxassay_018957_17 euxassay_018957_18 euxassay_018957_19
EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016 EMAGE:21016
euxassay_018957_20 euxassay_018957_21 euxassay_018957_22 euxassay_018957_23 euxassay_018957_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21016Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21016_wholemount_strong.wlz
21016_wholemount_moderate.wlz
21016_wholemount_weak.wlz
21016_wholemount_possible.wlz
21016_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21016_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
weak weak
regionalweak expression: see section 3 4 5 6 8 9 0 1
axial musculature
moderate moderate
regionalmoderate expression: see section 1 2 3 weak expression: see section 5 6 7 8
cranial musculature
moderate moderate
regionalmoderate expression: see section 3 4 weak expression: see section 2 3 4 5
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 1 2 3 4 weak expression: see section 1 2 3 4 5 6 7 8
thymus primordium
weak weak
regionalweak expression: see section 2 3 4 5 6
vibrissa
weak weak
regionalweak expression: see section 4 5 1 2 3
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 9 0 5 weak expression: see section 8 4 6 7
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 1 2 3 weak expression: see section 4
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 7 8 9 0 1
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 9 0 1 2 4 5 6 7
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 6 7 8 9 0 1 2 3
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 9
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 7 8 9 0 6 weak expression: see section 7
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 4
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 4 5 6 7 9 5 9 0 1 2 3
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 5 6 7 9 0 1 8 9 0 1 2 3
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 5 7 weak expression: see section 3 4
extrinsic ocular muscle
weak weak
regionalweak expression: see section 4 5 6 0 1 2
naris
moderate moderate
regionalmoderate expression: see section 8 weak expression: see section 9 0 1 6
tongue
moderate moderate
regionalmoderate expression: see section 0 1 6 7 weak expression: see section 5
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 9 3 5 7 8 9 weak expression: see section 1 2 4 6
lower jaw molar
moderate moderate
regionalmoderate expression: see section 7 8 9
palatal shelf
moderate moderate
regionalmoderate expression: see section 6 7 8 9 0 1 2
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 7 8 9 3 5 7 8 9 0 weak expression: see section 1 2 4 6
upper jaw molar
moderate moderate
regionalmoderate expression: see section 7 8 8 9
lung
weak weak
regionalweak expression: see section 4 5 6 7 8 9 0 1 2 5 6 7 8 9 0 1 2 3 4
clavicle
weak weak
regionalweak expression: see section 0 1 7 8 9
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50366
Entity Detected:Epha3, Eph receptor A3 ( MGI:99612)
Sequence:sense strand is shown

>T50366
TCGATATCGCTACCTTCCACACAACTGGTGATTGGCTTAACGGCATGAGGACAGCACACTGTAAGGAAAT
CTTCACAGGCGTCGAATACAGCTCCTGTGACACCATTGCCAAGATCTCCACAGATGACATGAAAAAGGTT
GGTGTCACTGTGGTTGGGCCACAGAAGAAGATCATCAGCACCATTAAAGCTCTAGAAACACAATCTAAGA
ATGGTCCAGTTCCAGTGTAAAGTCCTGGAGGGATGTGAGAAACGGGAAGATGCAGCAGCATCCTGCAGAC
AGATGGAAATGATAAATAAGATGCTGCAGAAAGCTCCAAGTCTAATAAGACACTCAGTTATAAGTCCAAA
TGCCTTAAAATGGAATTGAAAAATCTCTTTATTTTCCCCTATCATTTTACAGATGGGTGGGTGGGTGCAT
TTTGCTTTGTAATTGCTTTTTAAATGTTAATTGATGGGGTTAGTTAAAATTCTTCAGTATGAAGTGGAAG
AACTAGTGTAGAGCCATTGATCATTAACTATCATGGAAATAAACCAAGTAAACTAGCAAAACAGACCTGA
AGGCTTTGTTGTGAATGGCCACAGAGGAAAAGACTTGTCGTATTTTTATACACAGAAAAAAATCTGTAAC
AGGTATTTTGTTTCTTTTAAAAACAAGCAAAATGGAGGCATTTATACCTCAAACTATCTGGCCATACTTA
CTACCTTATCACGTTAGTATTCTCTTTATCTGTTTGAAGCATATAGAGATAAAGTTTGTAGTTGTTTTAA
ATACTATACATTTTTAATTGTTACCTTCCTTAAGTAGACCATGTAAAAACACGTCTTAATTTGGGGGCAA
GT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TCGATATCGCTACCTTCCACACAA; Reverse Primer - name:unspecified, sequence:ACTTGCCCCCAAATTAAGACGTG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_018957 same experiment
 EMAGE:21014 same embryo
 EMAGE:21015 same embryo
 EMAGE:21017 same embryo
 EMAGE:21018 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS