Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21055

Celsr3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) ( MGI:1858236)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055
"Pseudo-wholemount" of euxassay_007152. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007152_01 euxassay_007152_02 euxassay_007152_03 euxassay_007152_04
EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055
euxassay_007152_05 euxassay_007152_06 euxassay_007152_07 euxassay_007152_08 euxassay_007152_09
EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055
euxassay_007152_10 euxassay_007152_11 euxassay_007152_12 euxassay_007152_13 euxassay_007152_14
EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055
euxassay_007152_15 euxassay_007152_16 euxassay_007152_17 euxassay_007152_18 euxassay_007152_19
EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055 EMAGE:21055
euxassay_007152_20 euxassay_007152_21 euxassay_007152_22 euxassay_007152_23 euxassay_007152_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21055Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21055_wholemount_strong.wlz
21055_wholemount_moderate.wlz
21055_wholemount_weak.wlz
21055_wholemount_possible.wlz
21055_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21055_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
homogeneousmoderate expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 8
telencephalon
moderate moderate
homogeneousmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
hindbrain
moderate moderate
homogeneousmoderate expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1
midbrain
moderate moderate
homogeneousmoderate expression: see section 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 4 5 6 9 0 1
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 6 7 8 8 9
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 3 4 5 6 7 8 9 7 8 9 0 1 2
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 6 7 8 7 8 9
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 0 7 8
spinal cord
moderate moderate
homogeneousmoderate expression: see section 8 9 0 1 2 3 4 5 6
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 0 1 6
cervical ganglion
moderate moderate
regionalmoderate expression: see section 9 7
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 2 3 4
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 7 8 9 0 1 6 7 8
neural retina
moderate moderate
regionalmoderate expression: see section 1 2 3 4 3 4
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 9 0 1 2 3 5 6 7 weak expression: see section 8 9
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35136
Entity Detected:Celsr3, cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) ( MGI:1858236)
Sequence:sense strand is shown

>T35136
ATCTCGGAGTTGTCACCTGATTCAGAAGTTCCCAGAAGCGAGGGTCACTCCTGAGGGGCTGACCAGCGAA
TGAGGAGCCACCAGGGGTTGCAGAGGATTTGGGCTGACTGAAGAGCCTTCAGGACTGATCGCAAGGCAGC
CTTCTTCAAGCCCTCCCCTCAGTTCAGTGCAGAAGGAAGGTCCCTCCTGTGTGCGTCTGTGAGCATGTGT
GTGACAGGTGCAGGGGTGGGGGCTGAGGGAGGACTTTTATACATTTTTGTACCTTTGTAACCAGAGAGAT
ATGCTTATGTTATTTTTCAGCTTTTCTGTCTCCCAGGGGTCTCGAGACTGGGCTAGGAGGGGGAAGGGGA
TGGGAGAGAGACACTCCACTGGGCGCTTAGCTAAGCGTCTGCTCTTTCATTTCATCTTACAGCAGAGTGA
ATGAGTCAGGCCCCACCTGCTCTTTCCCCTTCTCTTCCCCACATTGATCTGAACGTTGTTGTTGGGGCCC
AGGGTGCAAATTTGATCTTTGCATTTTCTCCGATGCCCCTAGGCCAAACTCCTGTTGGGGGGGGGGATTG
GTCTTGGAAACAGGGGTTCCTCCATCCTCCTCCTGAGGGCTCACGTGCTCCACTCCTCCCTGTGGGTGTG
GATATGTATTACATGGAGTCCCTGCCGCTTACTGCCTTAAGACCTAGGACTGATGCTGCAGGTGCTGGTG
GAGCAGCAGAAGTCATGTTTACAGATCAAGGCTTCCCTTTCTCCCTTAGGGAGGGACTTGGGCCTCTAAT
CAGACATTCCTAGGGGGGTGGGTGGAGGGGAAACTCCTTTGTCCCTCCTTCACTTGTCTGTGGTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66590. Forward Primer - name:066590_F_cDNA_Celsr3, sequence:ATCTCGGAGTTGTCACCTGATT; Reverse Primer - name:066590_N_SP6_cDNA_Celsr3, sequence:GCACCACAGACAAGTGAAGGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007152 same experiment
 EMAGE:21054 same embryo
 EMAGE:21056 same embryo
 EMAGE:21057 same embryo
 EMAGE:21058 same embryo
 EMAGE:21059 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS