Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21059

Chrm2 cholinergic receptor, muscarinic 2, cardiac ( MGI:88397)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059
"Pseudo-wholemount" of euxassay_008297. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008297_01 euxassay_008297_02 euxassay_008297_03 euxassay_008297_04
EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059
euxassay_008297_05 euxassay_008297_06 euxassay_008297_07 euxassay_008297_08 euxassay_008297_09
EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059
euxassay_008297_10 euxassay_008297_11 euxassay_008297_12 euxassay_008297_13 euxassay_008297_14
EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059
euxassay_008297_15 euxassay_008297_16 euxassay_008297_17 euxassay_008297_18 euxassay_008297_19
EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059 EMAGE:21059
euxassay_008297_20 euxassay_008297_21 euxassay_008297_22 euxassay_008297_23 euxassay_008297_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21059Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21059_wholemount_strong.wlz
21059_wholemount_moderate.wlz
21059_wholemount_weak.wlz
21059_wholemount_possible.wlz
21059_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21059_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
strong strong
regionalstrong expression: see section 9 0 6 7
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 9 0 2 3 4 5 moderate expression: see section 7 8 6
telencephalon mantle layer
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 9 2 3 7 8 9 0 1 2 3 4 moderate expression: see section 7 8 4 6
not examined not examined
regionalnot examined expression: see section 5
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 3 4 5 6 7
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 3 4 5 6 7
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 9 0
pons mantle layer
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 2 3 4 5 6 7 8 9
midbrain mantle layer
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 3 5 6 7
facial vii ganglion
strong strong
spottedstrong expression: see section 5 6 9 0
glossopharyngeal ix ganglion
strong strong
spottedstrong expression: see section 6
trigeminal v ganglion
strong strong
spottedstrong expression: see section 3 4 5 6 8 9 0 1 2
trigeminal v nerve
strong strong
regionalstrong expression: see section 9 0 7
spinal cord mantle layer
strong strong
regionalstrong expression: see section 9 0 1 2 3 4 5
dorsal root ganglion
strong strong
spottedstrong expression: see section 8 9 0 6 7
esophagus
strong strong
regionalstrong expression: see section 2 3
tongue
strong strong
spottedstrong expression: see section 2
stomach
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2
rectum
strong strong
regionalstrong expression: see section 3
midgut
strong strong
regionalstrong expression: see section 8 9 0 1 2 3 4 5 6 7 8 9 0
lower lip
strong strong
regionalstrong expression: see section 9 moderate expression: see section 5 6 7 1 7 8 1 2
upper lip
strong strong
regionalstrong expression: see section 9 0 9 0 moderate expression: see section 5 6 7 8 1 7 8 1 2
bladder
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5
axial skeleton
strong strong
regionalstrong expression: see section 3
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35138
Entity Detected:Chrm2, cholinergic receptor, muscarinic 2, cardiac ( MGI:88397)
Sequence:sense strand is shown

>T35138
TAGGGGTAAGGACTGTGGAAGACGGGGAGTGCTACATTCAGTTCTTTTCCAACGCTGCCGTCACCTTTGG
CACTGCCATTGCGGCTTTCTATCTGCCTGTCATCATCATGACTGTGCTCTATTGGCACATATCCCGGGCG
AGCAAGAGCAGAATAAAGAAAGAAAAGAAGGAACCAGTGGCCAACCAAGACCCGGTGTCTCCCAGTCTAG
TGCAAGGAAGAATTGTAAAGCCAAACAACAACAACATGCCTGGTGGTGATGGTGGCCTGGAGCACAACAA
GATCCAGAATGGCAAGGCTCTGCGGGACGGTGGGACTGAAAACTGCGTTCAGGGGGAGGAGAAAGAAAGC
TCCAATGACTCCACGTCTGTCAGCGCCGTGGCCTCCAACATGAGAGATGATGAGATAACCCAGGATGAAA
ACACGGTTTCCACTTCCCTGGGCCACTCCAAAGATGACAACTCTAGGCAGACATGCATCAAAATTGTCAC
CAAGACCCAAAAGGGTGACGCATGCACACCAACAAGTACCACAGTAGAACTAGTTGGATCGTCAGGTCAG
AATGGGGATGAAAAGCAGAACATTGTAGCCCGCAAAATTGTGAAGATGACCAAGCAGCCTGCCAAAAAGA
AGCCTCCTCCATCCCGGGAAAAGAAAGTGACCAGGACAATCTTGGCTATCCTGTTGGCTTTCATCATCAC
GTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96634. Forward Primer - name:096634_F_cDNA_Chrm2, sequence:TAGGGGTAAGGACTGTGGAAGA; Reverse Primer - name:096634_N_SP6_cDNA_Chrm2, sequence:CACGTGATGATGAAAGCCAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008297 same experiment
 EMAGE:21054 same embryo
 EMAGE:21055 same embryo
 EMAGE:21056 same embryo
 EMAGE:21057 same embryo
 EMAGE:21058 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS