Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21104

Mir148b microRNA 148b ( MGI:3618734)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104
"Pseudo-wholemount" of euxassay_019206. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019206_01 euxassay_019206_02 euxassay_019206_03 euxassay_019206_04
EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104
euxassay_019206_05 euxassay_019206_06 euxassay_019206_07 euxassay_019206_08 euxassay_019206_09
EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104
euxassay_019206_10 euxassay_019206_11 euxassay_019206_12 euxassay_019206_13 euxassay_019206_14
EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104
euxassay_019206_15 euxassay_019206_16 euxassay_019206_17 euxassay_019206_18 euxassay_019206_19
EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104 EMAGE:21104
euxassay_019206_20 euxassay_019206_21 euxassay_019206_22 euxassay_019206_23 euxassay_019206_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21104Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21104_wholemount_strong.wlz
21104_wholemount_moderate.wlz
21104_wholemount_weak.wlz
21104_wholemount_possible.wlz
21104_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21104_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70279
Entity Detected:Mir148b, microRNA 148b ( MGI:3618734)
Sequence:sense strand is shown

>T70279
TCAGTGCATCACAGAACTTTGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-148b was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019206 same experiment
 EMAGE:21103 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS