EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21111

Mir16-1 microRNA 16-1 ( MGI:2676843)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019216. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019216_01	euxassay_019216_02	euxassay_019216_03	euxassay_019216_04

euxassay_019216_05	euxassay_019216_06	euxassay_019216_07	euxassay_019216_08	euxassay_019216_09

euxassay_019216_10	euxassay_019216_11	euxassay_019216_12	euxassay_019216_13	euxassay_019216_14

euxassay_019216_15	euxassay_019216_16	euxassay_019216_17	euxassay_019216_18	euxassay_019216_19

euxassay_019216_20	euxassay_019216_21	euxassay_019216_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

21111_wholemount_strong.wlz

21111_wholemount_moderate.wlz

21111_wholemount_weak.wlz

21111_wholemount_possible.wlz

21111_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:21111_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

telencephalon ventricular layer

moderate

regional

moderate expression: see section 7 8 weak expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 9 0 1 2

midbrain ventricular layer

weak

regional

weak expression: see section 3 4 7

upper lip

moderate

regional

moderate expression: see section 3 4 weak expression: see section 5 7 8

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70289
Entity Detected:	Mir16-1, microRNA 16-1 ( MGI:2676843)
Sequence:	sense strand is shown >T70289 TAGCAGCACGTAAATATTGGCG
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-16 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_019216 same experiment
	EMAGE:21112 same assay
	EMAGE:21113 same embryo
	EMAGE:21114 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source