Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21113

Mir17 microRNA 17 ( MGI:3619065)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113
"Pseudo-wholemount" of euxassay_019217. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019217_01 euxassay_019217_02 euxassay_019217_03 euxassay_019217_04
EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113
euxassay_019217_05 euxassay_019217_06 euxassay_019217_07 euxassay_019217_08 euxassay_019217_09
EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113
euxassay_019217_10 euxassay_019217_11 euxassay_019217_12 euxassay_019217_13 euxassay_019217_14
EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113
euxassay_019217_15 euxassay_019217_16 euxassay_019217_17 euxassay_019217_18 euxassay_019217_19
EMAGE:21113 EMAGE:21113 EMAGE:21113 EMAGE:21113
euxassay_019217_20 euxassay_019217_21 euxassay_019217_22 euxassay_019217_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21113Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21113_wholemount_strong.wlz
21113_wholemount_moderate.wlz
21113_wholemount_weak.wlz
21113_wholemount_possible.wlz
21113_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21113_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 7 8 weak expression: see section 0 1 2 9 0 1
midbrain ventricular layer
weak weak
regionalweak expression: see section 3 4 7 8
neural retina
weak weak
regionalweak expression: see section 1 2 3 4
metanephros
weak weak
regionalweak expression: see section 9 0 1 2 3 4 0 1 2
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70290
Entity Detected:Mir17, microRNA 17 ( MGI:3619065)
Sequence:sense strand is shown

>T70290
CAAAGTGCTTACAGTGCAGGTAG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-17 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019217 same experiment
 EMAGE:21111 same embryo
 EMAGE:21112 same embryo
 EMAGE:21114 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS