EMAGE mouse gene expression spatial database

EMAGE:21187

Mir101a microRNA 101a ( MGI:2676803)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019329. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019329_01	euxassay_019329_02	euxassay_019329_03	euxassay_019329_04

euxassay_019329_05	euxassay_019329_06	euxassay_019329_07	euxassay_019329_08	euxassay_019329_09

euxassay_019329_10	euxassay_019329_11	euxassay_019329_12	euxassay_019329_13	euxassay_019329_14

euxassay_019329_15	euxassay_019329_16	euxassay_019329_17	euxassay_019329_18	euxassay_019329_19

euxassay_019329_20	euxassay_019329_21	euxassay_019329_22	euxassay_019329_23	euxassay_019329_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70235
Entity Detected:	Mir101a, microRNA 101a ( MGI:2676803)
Sequence:	sense strand is shown >T70235 TACAGTACTGTGATAACTGAA
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-101a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_019329 same experiment
	EMAGE:21188 same embryo
	EMAGE:21189 same embryo
	EMAGE:21190 same embryo
	EMAGE:21191 same embryo
	EMAGE:21192 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source