Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21230

Ncam1 neural cell adhesion molecule 1 ( MGI:97281)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230
"Pseudo-wholemount" of euxassay_014138. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014138_01 euxassay_014138_02 euxassay_014138_03 euxassay_014138_04
EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230
euxassay_014138_05 euxassay_014138_06 euxassay_014138_07 euxassay_014138_08 euxassay_014138_09
EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230
euxassay_014138_10 euxassay_014138_11 euxassay_014138_12 euxassay_014138_13 euxassay_014138_14
EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230 EMAGE:21230
euxassay_014138_15 euxassay_014138_16 euxassay_014138_17 euxassay_014138_18 euxassay_014138_19
EMAGE:21230 EMAGE:21230 EMAGE:21230
euxassay_014138_20 euxassay_014138_21 euxassay_014138_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21230Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21230_wholemount_strong.wlz
21230_wholemount_moderate.wlz
21230_wholemount_weak.wlz
21230_wholemount_possible.wlz
21230_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21230_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
weak weak
regionalweak expression: see section 1 3 4 5 1 2
upper leg muscle
weak weak
regionalweak expression: see section 3 4 5 6 7 8 7 8 9 0 2
diaphragm
weak weak
regionalweak expression: see section 2 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
pericardial cavity
weak weak
regionalweak expression: see section 3
forearm rest of mesenchyme
weak weak
regionalweak expression: see section 1 2
upper arm rest of mesenchyme
weak weak
regionalweak expression: see section 2
hand
weak weak
regionalweak expression: see section 2 3 4 5
lower leg rest of mesenchyme
weak weak
regionalweak expression: see section 1 2 3 4
vertebral axis musculature
weak weak
regionalweak expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
brain
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 moderate expression: see section 1 2
vibrissa dermal component
moderate moderate
regionalmoderate expression: see section 5 6 7 8 1 2
facial vii ganglion
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 5 6 6
trigeminal v ganglion
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 6 7 8 9 0
vagus x ganglion
strong strong
regionalstrong expression: see section 7 8
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 7 moderate expression: see section 5 6 7 weak expression: see section 6
trigeminal v nerve
strong strong
regionalstrong expression: see section 9 6
spinal cord
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 3 4 5
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 8 3 4
cervical ganglion
strong strong
regionalstrong expression: see section 7 8 5 6
thoracic ganglion
strong strong
regionalstrong expression: see section 9 0 1 2 3
dorsal root ganglion
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3 4 5 6
neural retina
strong strong
regionalstrong expression: see section 1 2 3 2
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 9 0 1 2 3 4 5 6 7 8
vomeronasal organ
strong strong
regionalstrong expression: see section 3 6
tongue muscle
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6
stomach
weak weak
regionalweak expression: see section 4 5 6 7 8 9 0
midgut
weak weak
regionalweak expression: see section 0 1 2 3 4 5 6 7 8 9 0
bladder
weak weak
regionalweak expression: see section 2 3 4 5
ureter
moderate moderate
regionalmoderate expression: see section 9 0 5 6
renal cortex
moderate moderate
regionalmoderate expression: see section 6 7 8 9 5 6 7 8
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39423
Entity Detected:Ncam1, neural cell adhesion molecule 1 ( MGI:97281)
Sequence:sense strand is shown

>T39423
TCAAGTACAAGGCTGAGTGGAAGTCGCTGGGCGAAGAATCCTGGCATTTCAAGTGGTATGATGCCAAAGA
AGCCAACATGGAAGGCATTGTCACCATCATGGGCCTGAAACCTGAGACGAGGTACTCGGTACGACTGGCG
GCCCTCAACGGCAAGGGGCTGGGCGAGATCAGTGCAGCCACTGAGTTCAAGACACAGCCAGTCCGTAAAA
GCTCTTTGTTCTGATTAGAGGAATAAACCTGGAGCCACAGCCTGGCACGAATTTTCTCCCTGTCTCCAAT
AGATACAGCAAAGACATTTGAAAGATTTGCTCTTGCCATCAATTCATGTCTAGAATTCAACAGTCCTTGC
AACCTTGACATGGCAATTTGATAACTTGACAGCCTTTAGTTTAATATTTTTCCCTCAAGAAATCTGGTCA
TACCAACTGCCCTCTCAGTAAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 178006. Forward Primer - name:178006_F_cDNA_Ncam1, sequence:TCAAGTACAAGGCTGAGTGGAA; Reverse Primer - name:178006_N_SP6_cDNA_Ncam1, sequence:GCTTTACTGAGAGGGCAGTTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014138 same experiment
 EMAGE:21229 same embryo
 EMAGE:21231 same embryo
 EMAGE:21232 same embryo
 EMAGE:21233 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS